Description :
From Genome Similarity Track
Location :
Scaffold_75:39196- 41763
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.5Fumarylacetoacetate (FAA) hydrolase
Pytve_DAOMBR484maker-pve_contig_75-fgenesh-gene-0.6Metalloprotease family M48X

Sequence
2567 bases(100 bases per row)
GCCACGCACCTGATCCGCTTCGTCGACGAGACGGGCGCCACGCGCTGCGGCCAGCGCGACGCAGCCGCCTCCACCTCCGCGTGGCTCGTGGAGGGTGACG
ACCCGCTCGGCAGCCTGCGCTTCACGGGCCAGCGCGCCGAGGTGAAGAAGCTGCTGGCGCCAGTGGAGCCGTCGCAGATCCTGTGCATCGGGCTCAACTA
CCGCAAGCATGCGAAGGAGACGAACATGCCCGAGCCCAAGTACCCCGTGCTGTTCACCAAGGGAATCAATGCGCTGCAGCACCCGGACGGACCGATCGTG
ATCCCGCGGATCGCGAGCGACCCGCCCGAGGTCGACTACGAGTGCGAGCTCGCGGTCGTGCTCAAGGAGTCCTGCCGCAACGTGAGCGAGGCTGACGCGC
TCAAGTACGTCGGCGGGTACTCGTGCGCCAACGACGTGTCGGCGCGTCGCTGGCAGGGGAAGCGCGGCGGCGGCCAGTGGTGCCGCTCCAAGACGTTCGA
CACGTTCTGCCCGCTCGGCCCCGTGCTCGTGACGCCCGACGTGATCCCGGACCCGCAGGCGCTCGGCATCGCCACCTACCTGAACGGCCAGCAGATGCAG
AAGTCGAGCACGGGCGACATGATCTTCTCGGTCGCGCAGCTCATCAGTTTCCTGTCCCAGGACGTGACGCTGCCGCGCGGCACGCTCATCATCACGGGCA
CTCCGGAGGTAAGTGAAGAGCTTGGATTTGACAGTCGTGGTCCAGCAGATCGATGACGATCGCGTCTGACTTCAACATCAGGCTCCAGCGTGTGTGGCGA
TGAGTATGATGGTGCTAATGATGGGTGTGGTGTGTGTGACGATGACAGGGCGTAGGCTTCACGCGCAGCCCGCCCGTGTGGCTCAAGCCGGGCGACGTCG
TCGAGGTCGAGATCGAGCGCATCGGCAAGCTCGTCAACCCGGTCGTGAGCGCCTCGGCGCTCTAGGCAGTCTGCTGTCTGGCATGGCTTCACACTCGCTC
AATTGATGGATCATTTGACCGTTGGATGGATGCGATCACGAAACACACGCATGTTGGCATGTTTAGTCATTTAAACTCCCGTTTTGCTATTGCGTGTCGC
ACAAATAGTGCAGTTCCAATTTACACCAATCACCAGCTCCTTGGCAGCATTTATTGTTGAATAAAAATGCAGACCGTTGGGTAAAATGTCAAACGCAACG
GCACTATGACATTTCGCGCACCGCTGATTCGCGACACTCCCTGCCTCGTCATTGGCCGAGAGCGTCAGCATGTGGCCCGCAACGCAGCGATGACACCGCC
CGCGGCCAGACTCCTCTTCGCGCCGTCTCGGCTCGCTCACTCGCGCTCCGTCCAGCTCCAGGCAACGTCGAGCGTCATCGCCTCGAGGTCAGGCGGACGC
TTGTCCTCGGTTGAAGTCGCGTCCTCGGTGAAGCTCGCCGCCTTCGACTGCATCCCACTGTGTCGCTGTTAAGCTTCGCATTACACGGCCGCGTCTCGCT
GCCACGGGTGCAAAGGCAAGCGCGGGCATAGTGAAGTCAAGTCAACTCGGCGACTGCGGCGCACAGACACGAACCATTGTCAGCATAGACACGGGGGACA
TTGGCGTCACGGCAGCTCCGCTCGACTTGCACTCGGTATCGCCTGAAATCGCATCGTGACCATGCCCGGCGGAACGCAATGGCGGTCGCCGAGCGCTCGA
CCGCACACTTTGCGATTCGACTGGCCCACGGCACGGAGACTCATGGCGGCGGCCATCTACTCGAAGCGGCTCGTCGGCGCCTCGGCGCTGTTCATCTACG
CGTACGCGTCGTACCCGTTGGCGGAACCCACTAGTCCGTTCTCGCTCAGCCTGGCTGACGGCCAGGACTCGGTCCAGCTCGACCGACGCGACCCATTCGC
CATCAATGTGCGTGCAGTCGCAGCCCGCATGGGCGTCAAGCATCCCGAGCGACTGGCGATCCATGTCGGCGAGCAGACGTCCGGCGCGGCCGTGGGGGCC
AACGCCACCATTGCACGTCGCGGAGCGTGCATTGTGCTGCCTGCGGAGCTGTACGACGCGTTCCACGCGCCGGCGTCGCTGCGCGAGAAGTACGACTTCC
CGTCGCAGGACGAGATCGACTTTGTGCTTGCCCACGAGAGCACGCACATTGCCAAGAACCACGCGATCGTGTCCGGCACGTGGCTACCGCTGTCGCTGGT
GGCGAGCAACTTTGCGATCCGCAAGATCCCGAACAAGGTGCTGGCGGGCGTCGTCGGCGTGGTGGGCATCATCGGCTCCAACACGCTGCTGTCGTGGCAC
CTCGAGCACGAGGCGGACCACGCGGCCGCGCAGCAGGGCTTTGCGCATGGCGGCATCGACTGCTTCCAGCGCAAGCTGCAGCGCAACTGCCAGCTGCGAC
GCGAGTTCAACGCCAACTTCATCACCGAGCAGGGCAACTACCTCGGCGACACGTCCCACCCGCTGCTGACCTCGCGCGTGCGGCACCTGCAGCACGTCGC
GGCCAGCAACGTGCTCGAGGCGGCCTCCCACCCGGGCGACGCCTGCAGCTACTGCCTCAAGCTGTGA