Description :
From Genome Similarity Track
Location :
Scaffold_11:391901- 417946
Transcript NameFunction/comments
Phyra_75161DEAD/DEAH box RNA helicase, putative
Phyra_94064Hypothetical protein
Phyra_75163PREDICTED: predicted protein-like
Phyra_75164ELMO domain-containing protein 3
Phyra_75165Hypothetical protein
Phyra_75166Gag-Pol polyprotein

Sequence
26045 bases(100 bases per row)
CTCGAGAACTTCCAGCTCACCGAACTTGTCAGTGGTTCGCGAACCGAAATGCCCATGGGGCGCGAGGACCACCTGTCGAAATGCGCTGCTGCTGACCACC
ATCAACGGCACTGGTGACTTAGTGTTTAGCGTGGTTATGTTCGTGCGCCACCCCGGTGGTCAGTGATCAACGGTCTCGCCACCGCGCTCACCGTCGTGGC
CTGCGACGTTATGATCATGGCGACGCGGTCTGCAACTAGGCATAACGAATAACCGAGAAATGGTTTTGGTTCAGGATTCGGGCCCATTTCGCGCATATAT
CATCTACCTGTGCTGCTCATACAGAAGCATCAAGTGCGAGACAAAGTTTCTTGCCAAAGTGATTTTTGACAAAGTGTGCACCATACCGTTCACTTAACCG
AGGGAGTCTCCGCCGTAGCCCTCATTCTTCCCAGCAAGGAAGTCGCGCTTGCCAGCACCAATCTTCCGCACCTGCGAGTCCACCTTCGGACAGTCCGTGA
TACGGTGACCCAGACCACCACAGAACGCACAGCCCTTCGTGCCTGTGGCGTTGGAAAGTCCGTCGCCACTGCGCTCCAACTCCTCGTAAGGATCCTCCAG
TGCCTTGAGCACGGGCGGGACGGTTTGCTTGGCTTCAACGAGCAGATGCTTCAGATCCAGCAGTGCACTCTCGGGAACGCTCTTGTTGATAAAGGTCGTG
GCGACGCCGGTCTTTCCACAACGACCTGTACGACCGATTCGATGCACGTAGTTTTCGATCTCTGCAGGCATGTCGAAGTTGATGACGTGCTTGATATCCG
GAAAATCAAGACCCTTGGCAGCGACATCTGTGGCGACCAGCACGTCCTTGTGCCCATTCTTGAAGAAGTCGATGGCCTCGTTACGCTCCTCTTGGTCCTT
GCCACCATGAATCGAGGCCGCCTCAATACCCTTCAGAATCAGGTACTCGTAGATATCATCCACGTCGCCCTTGCGCTCACAAAAAATAACAACGGGCGGA
CTCGTCTTCTGCAAGCACTCCAGCAAGTAGACAATCTTTGCGTCCTGCTTCACGTACTCGACTTCCTGAATCACATCCAGGTTGGCAGCACCGGCACGAC
CCACGTTCACCAGAACCGGCTTTACCAGTACGTCCTTGGCGAAATCCTGGAACTTTTGAGGCATCGTAGCCGAGAACAGCAGCGTCTGTCGCTGACTTGT
AAAGTGGTTGAAGGTCGTGGCCACTTCCTCGTCGAAGCCCAGATCCAGCATACGATCACCTTCATCCAGGCAAATGTACTTACACAGTCGCAAATTCATT
TCTCGCAACTTGAGGAAGTGGTTCAGCCGACCAGGAGTAGCCACCACGATATGTACCCCACGACTAGAGATTAAGTCGGACTGTTGACGCTTGTCTTCTC
CTCCGATACACAGCAAACTTCGGAGCTCTGGGTATCCTGCTTTGAAGAGGTGGTTCGTGAAGTGCTTCACCACGTCAAACGTCTGTCTCATGAGCTCCCG
CGATGGTCCGACAATCAGTCCAAACGGACCTTCATGTCCAACGATGGGCATCTTTTTCTCCTCCTCCAGCGCCAGCATCACGAGCGGCAGCGTGAACGTC
ACCGTCTTGCCGGAGCCCGTGAACGCGATGCCGATCATGTCCCTCCCCGCCAGAATGCACGGGATGGCTTGCACTTGGATGGGCGTGGGTCTCAGGATGT
TCTTGGCCTTGAGTGCATCCAGTATGGCCTTGGGGAAGCGCATGAACTCGAACGACTTGATGGGCGGCGGTACATCCTGCCCTTCGACGAGGATGTGCCA
CTTCTTGCGCACGGCATCGCACTCGTCGGACGTCATGTCGGCAATGCTGCGTGGCGGTCTCCATGTCGTCTTCATGGTCTCCTGGTAGTGGATCCCTTCC
GCCCGCTCGTGGGCCGACACGAGCGCCGCCTTCTGCACGTAGCTGGCCTCCTTGAGCATCGTCACCTCATGCGCGTCCTGCTGCGCCTTGTGCTGATTCA
CGCCCTGCGCTTCCAGCCGTTTGCGCATCTCGTACGCCTGGTCCAGCAGACTCACGCTCGAGCGAGCGTCTGGCACGGCCAGAGATGCATCCTCCTCGTC
CGTCTTGGGCCGCTTCGCCGGCTGTTCCGAATCGCTGTCGCTGTCGCTGTCTTGATGGGTACGCTCCTGCAGCACCTTCCTCCGTCGCTGCAGGCGCTCC
TGTTCGCGCTGGCGTCGCACCTTAAGCGGCACGTACAGCGCTTCCTCCGCCATGGCTGTTTTTTTTGACAGCGACTAAATGTTAATGTCAAATTGATAAT
GCCAATTATGTCAAAAACACAGCAAAAGAGGCATACAAAAGGCAAGTCGAGTGAGTATCCTGTCGACAAATGAGCAGCTCCTCGCCACGCTGGCTCCGGC
CTGCGCAATTCCTCGTGTATCTCGTGCCCGTAGGTGGAATCCCGTCGGACGTGTTCGCGGCCTATGCGCGCCTGCTGCAGAGGCACAGCGTGCTGCCTTT
GCGCAGCTTGACGCGCCCCGGGGGCTACGCAGCCGAGCTGTCTCCGTTCCGAGGTCTGGACTGGGGCGGCAATGGCGTCCTGCGCTTCGTGTTCGTGTCG
GCAGCCGAGCGCGTGGACGTGTGCGACGGAGAGGACGCACATGCGAGTCGCCGCGTCGTGGGTGTACTGGGCGTGTGCCACAGTCCGTCGCTCACGCTGC
GGGACGGGCTACGTGCCGCCCACGCGCAGTTCGAGGCGTCGGTGCGGCGGTTCCCGGGGCTGCTGCTGCACAAATTGTTCGCCTTCGAGCACGCCTTCGA
GGACGCCACAGCGCGGGAGACGCAGGGGCTCGCGGACCTCGTCATGTTCCCCGTGCACCACGAGCTGCCGGGCACGGGCGAGTCCACGGTGAGTCTCCAC
CTGCAGGTCGTCATGGACACGCTGGCGGTCACTGTGCTCATGTCGCTGGAGAGTGTCATCCGGTCTGCCACGTCCACCGCTGCGGGCGGAGACCTCTCCA
GTGTCCTCCTGGACGTCAACGTGGAGCCCCAGCAGACGCAGACGACGCAACACACAACGTCGTCGCCCCTCGTGCTCGCACGGGAGGCCAAAGGAGACAC
CATGATGAACTCGGCGACGAGTCCCACGTCGCGCTCGTCGTTCGCATCCATTTCGTCACCTCTGGCTGCCGCGCTGGACCCGCGCAATCGACGGCGTAAA
CGGCAACTGGCACGCCGGGAGAAGCTGCTGGGGGATTACAGCGTGCTCGTGAGTTGTGTCTCGGACGCGGTGGACCACTACACAGTAGCAATAGAAATGT
TGCGCGAGGAAGAGCGGCGCAGTGGCGGCGCACCCGGTGACGCCTTGTGGCTTGCATCGGCGCTGGAGGGGTTTGTATTTTGTTTGTACACAGAGGCACG
GGACAAGTTTTCGACCGAGCTGGTGGAAAAAGCGTCGGAGGCCGTCGCGCTGTACGCGAAGGCCGGTACGACTGAGCTTGAGAGTCTGTTGATTGAGAAC
CTCGGGTGGTATTATGCGAGCTTGGCGACGGCGACGTTAGCGCGCACGTCAATACCAGGAGAAGCTAAAGTGCTTGAAAACGTCTGGGCTAAACGCTTGT
TGTGGGATGCGCTGGAACGAGGGCTAATGCTGTTCCCGGAGCTGCAGCCGCAGCGCCAGGTAGAATTTTTGATCCAGACAAGTCGAATGCTGGAGAGTGT
GGGCCACCGCCGGCGTGTGGCATTCTTTCTTCACGAAGCTGCTTCCCTTTTGTTGGCCCGCAATTCGCCTTCTGTGGACTCGCAGTTGAGGCTACTGCTC
TCACCTTCGAGTGTGACGAAGGGGCCTCAGCGACAGAGGGATTTGGAGGCAGCTCTCTTGCTAGAACGAGTTGCGGCGGAACACTTGGGTATCAAAGATC
AGAGTGATCGGAGAGATGATTTACCGTGGGAAGTCACGACACAATACCGCAGAAACAGGAGGAAAAAGGCGGCGGAGATAAATGCATCTACGGGTGCTCC
AGACAACTCGTGGCTGATCATACGCTTTCACGTGTTGCGGCAATTGCTTACGATTGCGAGGATGTTGGGGGATGCACTCCTCGTGGGGTCGTACTGCCTC
CAACTGTTAGAGATGCTGGTGTGGTGTGATTCTATCGCAACACCGACCGTGGACTCGTCGCCGTCTTCCTCGTCACCAGCTTTGACAAGGGTGCCCGCGA
CGCTACAAGTGGACCACCTCCAGCAGTCTGCTGCCTCGCTTCGGGTTATCCAATCCCCTGTAGAGCGTGTTGGGGTGGGGCTTCACGCCAAGAGTAGTGC
ATACTTCTCTCCACCGCCGGGAATTGACACAAGGGTCAGACGCAACTTCATCAACTCCCCGTCAGCCACCATGTCTAATGCAGCCGCAACCATATCGTCA
ACTCTGACCAACACACCGCGGCTTCTAGCAACACCGCGGCAACAATTCTCCGCTGCAGTGAATGCAATATCTACGAAGGCGTCACCGGCATTCGCACCAT
TTTCTCATGCACACAACCTTCACAATGGAGCTATGGCAGGCCATTCAGGTGGCACCGAAGACCGTACATCGACGCCTAGGATGACTAACGTGTCTGATGG
AAAGGAGTTTGGTGCAGTTGGAGTGAATGCCGATGGCGGGCAGAAAAGTGCCCGAACGTTAGGTGTTGCTGATGGTGAAGTAGAGCGTCTTGGTACGGTG
GCAGATGCCGCTCCTGTCTGGAATTTGCGGTCAAAGACAGAAATTGCCAAAATCCAGCGGAAACTCCTCAACGTGCTGGAGTCTGACTGCACAGCGCTGC
GATCTAGTGAACAGATACAACTGCCCACATTTCTGCGAGTGGACAAACTCAAGCTTCGTTCACGGTGCAACTTGCGGCACCCCTTTCTATCTCGAGAGAC
AGCTCTGGGGGTGTTTGGAGTGCAATCGGGTTCTAGTAAGCAGGAAGCAAAATCAGACTTCTTTTATTCACCTTTCGAGAAGCAGAAGATGATGCGGAAG
GCGAGTCAACACGGGAGTGATGACGAAGATGACAATGACGATGCGCCAGCTATGTATGAACGGGGGTTCCCTGTTCATGAGCGGGTCGAGCTGCAGCTGA
CCTTGTCGAATCCAACGGGCGTTGCTGTCAAGCTCCAGCAAGTTAAAGCGTGGGTTACGTTCATTGAGGACGGTGGCGAAGGAAGCGGCATGAACGAAGA
TACGAAAGATGGTGGTGTTGAGTGTTACCCTTGTTTTTTCACGCTTGGGCCGTATGAAAAGCGTAAAACGGTGCTGCTGGGGATTCAACCTTTAAAGGTG
GGAACCTTCCACGTTCGCGGTTGCTTCATAAGGGCGTTTAACATCAAGACATCCTTCGAGCTGAAAATCCCTGTCATCATCCGAGTCGTAGGCGAGTTGC
CGATGGTTTCGCTGTCTCTGCGTGAGCATGGCTCGATAGCACTTTCGGAAGGCGAGAAAACTGCTGCCGCGGCGATGATAAAACAACCGCCGAATGCCAA
GATACGTATCGCGATGTTTGCAACCGAGGCGAAACGATGCGTAATTCGTGTGCGCAGCACTGGAAACCAGCAAATCACGAACTACAGGCTAGCAGTCACT
GTCCAGCATCGACGTGCAGCCAAGAACACGTGTGTAGTTTTCAACAACTTGCCGTCAGCCTCCGCTGCATTGGAGGGTAGCATACAGACTTCAGATGCTT
CATCCAGCAACGCCAATGGCAAGGCAGCCATCAATGGTCAGATTGAGACACAGCATCTAGCGTTGAGCTGCGCTGAGGTTGTATCCTCTCCACTCCCGCT
CACGAGCGGTGACTTCGTGAGTATTCCTTTTGAAATATCGCTTCGAGGAAAGAACGACCAAGGCGAGCCCCTGGATGACGATATCCAGATAGAATGGAGT
TTCGTGTACGCGGACGAGGCTCGCTCAGGTGGAAATGGTGCGGTAGACAATATCTTCTATCGAGAGAGCAAACTGCTATTGGAGTTAGTGTCACTTCCGT
CGCTGACGCTTCGGTCGGTGTCATTGCTATCTTGCAGCGTAGAGCAGATCCCATTGAACGGTTTGGACGCGGGCAAGGGAAGTGTGGCTTTCTGTGATGG
TAGCCCAACACAGCCCGTGACGACGGATCATCCTTACTGTGCTGTCATGGTTCACATCGTCAACCCGACAGAAACTACATTTCGTTTTCGGCTGCTCCGC
GACCTTGACGACAGTGATGATGCCACTTGCAAAGCTGAAATCGGGCGTCAGTGCTCTCGCCGGTTTGTGGTTGAAGTTCCTCGCTTACGAACCTTTGCTG
TTGAACAAGAGTCTGCCAATTTACCCGAAGTGCTAAACGACCTGCTGCAGATGGAATGGGGAACTTACTTTGGGACACATGGGCGCCTGCTGTGTGAGAA
ACATCACTTTGGATCGATCGCTGAGCAGGAACAGGCGCAGCTTGAGCTTCTGTTACCGCCAGTAAGTTTCCAGATCCAGTCGCCTCTAGCCGAAAGTGTG
CCAGTGGGGACGAGCGAACTGGAGAATGGAGGTGTCTCTGAGTCAAAGCGTGTAAGAAACAGAAGCTCATCGCTCCACCCGTTGAGCTTCTTCCAGGTGA
CGCATTTACGTGCTGACTCCCGGGCGCTTCAGGTTGGACTGCTCCAATATGTTCCGATCGACATCGTAATTCAGCGGGCAGTCGACGGTAATGCTAGAAA
TCAGCAAGTATGGGGCGTGGAAGTGGAGGTGATGATCACGGAAGAAGGCGACGAAAATGATTGCCAGGCAAGTGACCACGCTATGGTTGTAGGCTTGCTT
AAAGCACAAGTCCGCTGGGATGGTCCGATGGACGGCGCTGCAAAGTGCCACAAGATTCAGTGTATGTTTGTGTCGGAGGGGAATTTTCGCGTCACGGTGT
GCGGTCGGGTGCTAACCCCGGATATGCAGCAAGTTGGTGGCGCGGTTTGGTGCCATCAGCCGTTGCATATTTGCGTTCGATCGGAAGACGTTATTGTCGC
GGAGAAGACCGCGAGTATTATTTAAGAGTGATAAGAGATCTGTCTATCAGCGTGCGTTCATGCTGGTCAACATCCTGGCAGAAAACATTCATTCTACTAG
AGTGATGGTCAAACTTCAACTTGCGGCTCATTTATAGTGTTTGAAACGTGCTACTTTGGTATTTGTGGAAGTGTTAGGTGCAGCCCCAAGCGACTGTCGA
ATCGACGTGTACGCAGCATGGTGCGTAGTGAGGCGATGGGGAACGACTACTTCCAGATCCGCAAGCTGCTTTGGGACGAAATCAAGCTCAGTGTGCGCGC
GTCGGAGGAGGAGGAACTGCGCGGTGCTGTCGGGAGTCACCTGATCGAAGGAAACGAGGTTTGATGCTTTGTGCTCTGCAGTTTGCTGTGCAGTAGGGAC
TCAATTCAACTGCTGCGTGCTTGCATGACAGGATCTACGACAAGAGCTGGCGGTGCTGGCCGAGATTCTGACCGAGTTCCAGCAGCAAAACGATGACATC
CGGGTGCGCATTATTTCCTGTTCCTCGACATGCCAGTGCACTGACAGAGAGTTTTGCGACAGGATGCGCTAGCGAGGCGACCGCACATTCCTGAGCCGCC
AGGTCGACCTTTGCTGATCGAAAAGCTGAAGCTCTTGGCTGCAGACATGCACAAGAACCACAGCCAAGCGGGTGTTCCCTCTGCAAAGAACGCTGAAGTA
CTGGACTACGTATTATCGACCGCGGACACCTCCAACTCTTCTGCCTACCAGACGCCGATGACACCTAAAATGGAAGATCTATTGCCGAGAGCACTTTCAG
ACGACCAAGGAGACGGTGTTGTCCTTCGACCAGGCACTGCGAGCGGAAGGCGCCCCATGACTTCTGGTTCTCAGCGACCAGTGTCTAGAGGTTCAACGAT
ATCAATCTCCTCGGTCACGGCACTCCTCGAAAGCCCCGAGGTTATCCATTTCTTTTCCACATGCTGTGAGATGTTGGAGTTGACATCGTGTCGTATTGTA
TGCAGGTATATCGTCGTCTAAACCTTGACGAGATCGACGCGATCAAAGAGGATTTGCGAGACGCATTGCATGACGAGCGCCAGCTGTTGCTTGAAGATAT
TGATTTTATTCAGGTGCAGCTTCAGCCGTTGCGGCTTCTACCTGGGCAATGGCCTCTTGCTCAACTATGAACTACTTTGCAGGGCTGCTTGGAAATGGAG
AAGGACCTTATCGATGATGATCGACGAAAAGTTGCTGCAGTGAAGCCCCCGCCGACGCTGAGCGATTTACACGACCTTCGAAAGATGTTGGAGAAAACGC
TGGAGGACCAGGTAAAGTCAACTAATTTGACGTTAAATGCTGTGGTTGGTACGCGTGGTTGACTCTTTTCACCATCCGGCCGGGGGGGTGTAGGAGGCGG
TCGGAAAAATGGAAAGCATACTCAACAAAGCGAGGAACTCAAGTTCGTTTGTCCGAAGCCGAATGTACGTTCAGAGCTTCCTACTACGCGCCTGAAATGA
TTTCCCTGTGTTTTAATCAAACCACTCTTCTTGATGCAGGTTTACCCCAGTACCCCTACTTGAACCTTCGAGTTGTGCACCTCCGTCGCGAGGTGAGCTA
CCAGCGAGTGCACGACTCCCCTCTCTTAACGCCTCATTTTCAGCTTCACCTTCCTCTTCACTGTCGCGGGCCGGGGCAACAAGAGTGCTGAAAATTCGGC
ACCTTGTACAAGAGTCTAGAGATGAGCCTTATTTATCGTAACACAGCAGCAAACTTTGCGCAAGTCAACCTGACTTTGTGTCGCAGCCTGATTAACTGTA
ACCGCAAAGGCGGAGACCTATTCATGCGCTACCTGCTTCTTCTTTCAGGATCGAGGAGCTATCATTCTTCGTCGACAGACTGCAGCCCAATTTCGGTAAA
TTCGAGGTTGTTATCGGATTCTTTGCGTTCCGCTGTCTTCGTCTTCGTCTTGGATGGAGCGGCTGCAGGTCGGGAAGGACGCAGCGCAGTGCCATCGAAA
GCCTCGTCGATAATCTTGCTCGGATTTGACCGACCTCGGTCCAAAACATCCTTCATAATGAGAGGAATCTCATCCGTTCGGGACTGAATCATGTCGTGGA
GCTGCGAGGCCAGCGCAACATACAGCTGCACGATGGCACAGAAAAGATAAGCACCGTGTTAGCAGGGCAAGCCCCAAGCACAACATGAATAACTCACCCT
ATTCATGCCAGTCAGCACGCTGGCATGCTTGTTGCACTCAGGATACAGTACTCCACTTCGCAGCGCCACAACACACTGAAGCGTGACATTGATGAGCACA
CAGGCAAAGGGAAAGTGGCGAGTCGGGTGCTGAGAGAGTGCGTGAAAGCGGTGCGCGAGATCAGGATAGCTCTCGACCAAGTACAGAATTTGAAGTAGCG
AAAGTACACCGCATCCACGCAAGTCCGTGGATGGATCGGTGCCCTGAAACCCGATGTCCTCCCAATGTCTGCCGATGAGAAGAACGTCTCGAGAGCTCTT
CGTAATCTTCTTGTAGATTGTTTGCAGCACCCCCACCACGACATCGTTGTGGGCATCGAATGCAGTTGCAGCGATGCAAAACACACGATCACGCTCCTCG
ATTGCCCCAGCAAAAGTGAGGCGAGGGCGTGACAGACAGGTCAAGCACGAGGCACGAGGAAAGTCTTCAGAAACAATGATGTCTCTATGCTGCATGACGT
CGGGCGTCTCAGCATAGTACCCGGCTGCTTCTGCGTATGATGTCCGCGACACTGACGCTGCGTCGGGGCCGTTACCGGCCTTTACAGATCCCGACTCCTC
ACCTTCCTGCGATTGTCTGTGCTGAACCAGTTTGATCTCTCTCCACTCGGCCTGGTCGGCTTCACTTTTTTCAGTTATCGTTTTTGTGTCTTCAGCATTC
TCATCATCCGCTTTGGGGCTCTCAACATTCCTGTCGTTGTCTTCACCGTCAGTATCATCGCCGTTAACTTCTTCCGCTATGGTGTCGGTGGCTCCATGCG
TCTGACTAAAAATGCGGCCCATGACGGACATTGAACGACCCACTTCGGGAGCCTGACGTCCTTCACCTTTCTTGTTCTCTTCATCCATCAGAACTTCTTG
ATCTCCAAGGCCTCGCTTGTACATACTATGGAGCTCAGATAAGGATAGTGCATCGGAGTCAGCGGCTGCTGCAGCAGCAGCAGTTGTGGAGTCAGCTTGA
ACAGTTTCAGTCATTTTGTTGTTTTCGAGAACCCGCTTTTCTTCGTCAGTTGCCCGCTTGAGCTCTTCCATCAGTTCTTTCTCCTCTTTCCGCTTTTTAG
CCTCCAACGATTCCCGACGTGCTTTGAGAATATCTTCCGACAAAGTACTCGACTTGGCAGGCTCGATGTCGAAAGAAAACTCATCATCGTCGGCGTGAGC
AGAAGATTCATCATCTTTACTAGGACTTGTGTTGCCTGCTACTGAGAACGACAAGTCGCTTGTCAGCTCAATCTCATTTTCAAATTCCCTCTCGTCAGGG
AATGCTGGGCCACTAGGCAGGGAGTAGCTACCCTTCTTTTCATCAACAAGGAGCTCGTCACCCTTATCGCCCTTCTTACGCAGGCTCTGATACGAAATAC
CGAAAGTAGCGTCCACGCTGAGTTGACTCGACCTGGACCCACCAGCTATTTTGTGAATATCGGAAAAGGGGCTGCCTGGTTCGAGTGTCGTGACGTGCGC
AACGCGAACTTCTTCACCGAAGGAAAGATCAATTGCGCTCGTGCCGTCAACTTTACTGTTGGGTAATGCATTCAAAAGTGCACTGTCCTCATCGGTACTG
GCGTCGTCTACGGTTTTCATCGCTTGTGGTTGCTGCTCGGTGGATTGAGCGCGCATCGGTAGCCGCTGTTTCTCTTCAATCTGGATACTACTCACCACCG
CCGAATTGACTTCCAGTACGTCTTCATCTTCATCGTCTGGATTGCCTAGCTGCAACGGAGGTGGTAATATTGTGCTCTCAACATCTTCTTCACCCTGAGA
TTCGTCAGAGTCATCATTGTCGTCCTCCACAGGGTTCATCGAGCCAACGATGAGAGGGACAGCTGTGGGTGCTGGCGGAGGCACAGCAGCTAAGTCTGAG
GCCTTCTCATTGTCTTCACTAGCAGTATCGTGTACTAGTGGGGCCAGTGGCATGTCCAGCGTTTCAATTTTATAGTCAGCGTCGCTATCGATAGTTGGAG
CGGCCATCACGACTGTATCGTTCACAGATGTATCTCTTTCAACGTCATGAGCTGGGATTCCGCCTAAAACTTCCGTATCCGTCTCCATTTCACCACTTGA
TCTCTCTTCTTCATTCTCAACACTCTTTGGAGGTGGTGGCTCCTGCTCTTGAGTTGGTATTGTTGCCTCCAATTCGTTTGTTGCTGGTAGGGTAAGCTCT
TCATTAAGATGCGCATTTTTTGCAAGATCAAGCACAGCTTCCACAACGTCTTCGCCTGAGAGCGAGGACGGCTGCTCTGACTGCTTCGATTCCTGCGATA
TCGGGTCGTTATTCAGCTCCTTACCATTTCCGTCTATGGGAGAATGCGAGATCGTCTCGGTGTTTTTGTCTGCATCTGAAGAAATCTCGGATGTTAGGAT
GGTTTGAAATAGTCAAAGTCGAGTGCAGCATGATGAAACCTAAGCTAACACACCGTTTGCCGGCATCGGGGAGAAAGGTACCGACGTCGAGTCATGAAAC
TCCTCCGAGATGTCTGCCTGCGTTTCGTCCTCTATACACACACACAGAAGCAGCAGACAGAGCTGTCAGTTCTTTCACTCTGCAATTTGATCTCGTAGTC
TTCGTAGCAGCTAACCATCGAGTGTCGTTACGGCGTCCAACTGGCTCAGAATGTTGTCCATAGTTGCATCTCCCCCGCCTGACAGCACATGCCCAGTAAC
GTATTCGTCCGAATGAATGCAACGCATCAAGTACAATTTTCTCCAACCTTCGCCATCTTGGTCTGCGTCCGTATCGAAGTAAGCCTCGGCATCTGCATAG
ACACAACACTTAATTAAGAATGGCGCCCTACTAAGCCGAATGCCAAGTCAAACCTTCGAAGTCTTCTCCCTCGCCGTCCACATCGTGGAGCAGATCTGCA
GCAGCAACGCAACAGTTGTCAGCGACCTCGAGGACAAATTTCGACTTGACCCTCGCCCACACACCGTCCAGAACATCCACATCCGAAGGATCAGCAGATT
CCATCGCTCTTGTACGCCAGCTATAGAAGATATAGCAAGCACTCGCAATTTTCTCTCGCTCGTTTTGGCCGATTGAGTGTTGCCGAGCCCTCAAGACGAG
GCGTTGCTGCTTTCGCGACGTTTCGGCGGCGTAGTAAACTACGACGTTTTTTTTAGCCAATAGGCCTTTGACAAACTGATGGAAATTTATCCAAGTATTT
ATCCAAGTAATTTATCCACGGAATGTTGCGCAGGGATTAGTAAAGTTGTGCATTGGTTAGCACTTGTACCGTATCATACTTCTTTGATCCGACAACTTCT
TATATTCGACATCGCCCAGCAGCCACTTAAATCACAACGAATTGCACTAGTGAAAACTACTTCTTTTATCCGACTGTACCACTAGTGTACCAATCTTGCG
GCTATCACCACCATTTACTGCACTCTTGCAAGTGCAATGGCGAGCACAACTCGCTCACGACGAGGATGACAACGCTGTACTGGGGGCAAAGGTGCATCTG
TAAAGCAGTTCAAGCGCCGCACCGAGCCATACTGGATCAAGTTAGCAATTATCAACGACTTCAAAGCCAAGAACAACATGTCAGCAACGTTAGCGAGGTT
CTATCCAGGTTTAGGCGACAAGCAGCTAGAGACGAAGCGAAACTCGGTCTATTTGTGGGACTAGCAACGTGAGCACATCGAAAAGCAGTGCGCCGATACA
TCAGGTGCAGCCGGTCGCAGGATTCGGACTCTTGGAACAGCAACCCTTCTGTCTGCACAAGCGGAAGACGAGGTTGTGAGGTGAAGTGACTCGCCAGTTG
GAAGGATTGAGCGACCTGGAGGACTGATTGCATGAGATCACGTTTGGAGGAATCGCGATGGAAGGATTGCGGCTGTGTCCAGTTATGGCCGGTTGTGTCC
GGTTACGTCCAGTTATGTCATTTATGCCGACCTGATCAAGATCGATATTGAGCAATCATTTCGATACGCGATCTGGTCCAGATAGACATGCGACAAACAT
TGCGATACGCGATCGGCAATCACAATTGTTGTGGGTACAATGGACTTATCTTTTTGGAACGGGTACCGTGATCTTGGTACATGAGATCAAGTTCAAGCTG
CGGTGTGCAATCAAGAGATGCGCAAGCGGGATAGGGAGAGAGCAGGATAGGAAGAGATCTTTAGGGCCTTTACGTTTGGATAAGAGATTCAGATTTGCCT
TGAAAAACACAAGTAGCGTCCATACTTTCCGGGGAAGGAATTACATTGGCCTATCCGACGAAGGACCCGCCCAGTCAACCAAGGACACGACGCAGACCTG
GATACCTTGGTCAGGGTGAGATCGCATACTCTCATCTCAACTCAAGATCCCGCGAAGGGGAGGCGGCAAGCAACGGAAAGGGCTATCGCAGCACACCTGT
AGCGGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGCAACACGCACTAATGTATACATTCAGGTTGACCACTCCACATGGTCCACATTAATAGCAAAG
CCATATGACTGGTAGAAAGTAACATATTTCTACCAATGAGAGTCATTCATTAGATAGGGGTTCTGCCAGCCATCCAATGGCAGAACCTCTCATTAGAAAT
ATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTGGCACCAAAGCTATCGTTCGGTTCCTTTGTCTTAGTTTAAGTATACTTGCGG
ATACAAGTATACTGAACTTAAGTAAATTACTCCTACCCTTCCTCATACACAAAGCGTAACCCGCCCCACCGTTGGGTACACAAGGTAACTACAAGGTTTT
CCGATCACGTCTTTTCAACGGAGTATCCCCTCCGATAGTCGGCAGTCCGGGTACACCGCTGGCAAGCTTGGATCTCGTCAGCAATTTTCGTGATCCCGCT
TCGCCACAGTCGTGTTGTGGGTCCGAGCACTACGGGAGGGAGTGCCAGTGTCAGCTTTCATGCTACAGATTAGGGTGTTAGAAATAGCAAACGCGCTTAA
CATTCCACGGTATATCCTGTCAGCGGAATACAGCTTTCGACGAGGGCTCATTCGACGCCACGCCATATCGTTTCGCCGCAATACACACCAAGGCCACATT
GCACCGCTCGACGCAAGGGTTATAGCGGCAGAATTCAAGCAGAAAGTGCGGGCACGAATGGCTGATCTCGGCGTAGATCGCGTGTTCAACGCCGAACAGA
CTGCCGTGTTCTTCGAATACATTCCCAAGACTACTCTCTGCGCCAAGGGGTCCAAGACCGTGTGTGTTCGTAGCGGAGGTAAGGCCAAGGATCACGTCAG
TGTCATGCTGTTTGGAGACTCTCATGACAATAAGTTCCCCCCGTATATTGTGGCGAAGGTATCCCCGTCGAAGGTGCCGGCAACGAATGAGGACAGCATT
CGTCTCCGTCAAGGCTTTGGCACCAACATCTGGCGAGAGGTGAAGGAGCTACAGCGACACGGCAAAGTGGTGAAGCACGGCAACACCCGCGGCTGGTGGA
ATGAAGGCTTATCTGTGGCGTTTTTGGGGCACCATTTCGGTGATCGTGCCAACATGGCTATACCTGTCCTGCTAATGTGCGACGATCTGTCCGCTCACTG
GACATTCACAGTCTAAGAATGCGCTGACCGCCTTAAGTTGGAGCTCATTAAGGTGCCTACAGGCTGTACGGCTGTCTGTCAGCCAGCAGACATTAGCTGG
AACAGCCCGCTAATGGCGTCGCCTCCGCGTTCGATGGGTTAAGATGTTGCGTCAACAGCTAAAGGCCCCACGAGAAGAAAGAGTGAAGTTCAAGTTGGTT
GCACCAAAACGAAAGGACGTAGCAAATTGGGTGATCGAGGCCTGGGATAACGCGTCAGCAAAGGTTATCAAGAGCGGCTTCTCCTATCTAAAGCTGAGCA
ACGCATGCAGTTCTGTCCCACCTCCACTCGACGAATGTACGGTTGTTTTAGCTAACGATGTTGTGTCTCTTTTAGAGAGCGTTCATATGATGGATACGCA
AATTGGCCAGGTCTCAGATAGTCAAGATATGATCTCGTCGCAGCTTGGCACTGACTAAATATATGTAGAAACTCGTTTTCGCTTGACGCTATTTACTTGG
GAATGCGTGTATGCATGTGCGTATGCACGCGTGCGATCCCCCTGTGTGTGGATACTTTGTGGGCTCGGCGTTCGCTTTGGGAGGGTTCCGGGGTATAACG
CTTCTCCAGAACACGATTCTGACAACCATTTTTCATTTTTGACGAGTTTTTCATCAAAAGAGATGTTTGAAAATCATATGATACGTATATTGTAATCTTG
ACAATGTTCACTTGCCCTACACCTATCCGAAGATTTAGTGTCGGATCAAATAAGTATTATACGGTACTAGAATGATTCCCGCAGCTTAAATCCAAGGCCA
ACCTTCCAGACTTTGGATAAAAAGGACGGGAATGACCTTTTACTAAAAACAAGTTGAGCATCCGCGGGCGGTTGCTTAGGGGACGACTGCCTAATGTTGT
GTGAGCTCATAATTTTGGGAGACGCCCCGACCGTTGAGAAGAAAGATACTGCAACTTTTAGCCACAGCGATTTAGCTTGTCACGATGACCAAGGTGAACT
CCACCAAGGGCATTGGCAGCAAGCAGTGGACTGTTAAAGGTACCGTAGCTAATATCTGGAGGCGGCTGTTCATGGGATTATCCTTAATGATTTATGATGT
GTGATAAGAACGACGAATGCAAGGCAAGAAAACAGGTAAGCTTACAACAGAGACACGAAAAGATTGTGTGTTTATGCGTATGCATTACATTCAAAAACAA
TTATGGGTTATGCTATCTAAGCAGTCAGAGCTTCAGAACGTAAGGATGAAGATCGTCACGATTTTAAACCGCTAAGAGGCCCCCTAGCTGAGAAATTAAA
GGCGTCGGGCATTGATACCAGTGCGAGTAAATGACAAGACGAGCAAGCTCGTGCTGCTCACGCGCGAGCAGCAAATGAGAAGAAAGCACATGCAGTACGA
GTCAAAGTAAAATCTGAAAGATTAGTTTTATATACCATACATTCATACAACCGCTGCTGCTGCTACTATGCATATGCGTCATTGTGCACCAATACATTTT
GACGCTGATAGCTAGTCCTTATTTTTCGATGGGACGTGGTGGAACGCCAGCGGCGCGATTAATTGCAGCAATGCTTTCACTAATCATCTGGAAGCTGACA
TCTCCCCTTATTCCAGCTAGTCGCAGAGAATTGAAACGTCCTGGCACTTCGTGAAACTTGCGTCTCTGTTTCTTCTCGGCTGTCAGGGCCTCCAGTGTTC
ACCGCGCTTGCTCACGTCGTGTTTCCTGTCGTTCCAGAAGGTAGCGTTCTTGTTTTGAAGGGGAGGGATCGCATCACCATCGGACGTGTCACCGCTTTGA
GTGCGTGATCGCTTGGACAGTGAAAACAAAAACTCCAATCAAGGTCCAATCTTCTGACCGAATTTTATGCCACTGAAAGGTTTTGTTGGGAGGTCTTGCT
GGCGGAGTACTGGTTTGCGAAGCCGAGATGGCGTCGACGATCCAAACGCAATACCTGCCGTCTTTGTCGTGGCTGTATGATTGACAGGCGAAGCCGGCTG
CGTTTCCATATCTGCGCCTTCGGAATCACAAGGTAAATCGAGTAATGGCGAATATACCGTGAAACTACATGAAAGTCGGGCATCACAAGATAGTAGCAGC
TGAGACCTAATGTACTGGCAACCAAAATAACACTTAAAAACTATGGGAGATTTACCGGGGTTGCTGCAATCGATTGTTAAGGAGGGCTACTTGCTTCACT
GTCACGACCACAGCTGCCACAGCGCTTTTAGTTTTCAGAACAGCTTTGTCTACTCACTCTTCCTCATTAGAATATACCACATTGCTGCCGCGAAGTAGAT
AACTTATTTAGCGATAGTGATGACGTGAGAACAATATCGTCTCGACAACGCACTCTATAAAGTACTACATTTGCAAATGAAGCGTTTGGTACTCTTACTA
AATGGAAAACAATATTTTCACGGGTTAAACCTTGAACCTTATGAACTTTAATTGCGTAAGATAAACGTAGCTGCATACCTTCCCGAAAAACACTCAGATC
GCTCAATTTATCGGTCCAGCTTATTTTCCTATGAATAACCGGCACAGCGTTTGGTATACCGGGCAGAAAGTATGGACCAAAGTACAAATCGGTAACCTGG
ACAAGAATTATTGGTAAGACCGAGTCTGCGCAAAAATGAAGTCGTATATTACTCCGTTTATACAATTAAATAGCCCAGCTGATTGGTGCATGTTAAATGT
CAGAGTCACAGGTGCACCGACGGCTAGCTTGACTTTAATACCAACCACTGTATCTCTGTTTGCATTCGCTATCTCAGCCGACTGTTTTAGCGCTCGGACA
GACTCCGCTGAAATACCTCGCTGCTTTGCTAGTCGCTTCAGCTGAATCGTATGTTTTGACCTAATTTGAACAATGGGGGAAACACTAGAATTTAAGCTGC
AAAGGTTAGCTGTGGCGACATCAGCATTGAGATATGCAATGTGTTTATCTGTCGGTGCCCAATACGGTATATGCAGCGGTTTGAAATATCTAGTGTCAAA
CAGCGCGACATCTTCTCGTGTGACGCATTGTCGACGTAGGCTATTTAAAGCTGCAAACCATTCAGGATCAGCTCCCCTGATTTGCAGCATACGTGTGGAA
TAGGCTCCCAAAGTTATCGGCCTCCTTGCTGAACACAATTGTGAATTATGGAGAGCGGAGTGGATAGCGAGTGGGGGATTACAGGGTCGAGTTTTGCGCG
GTCTCCAGTAAACATTAAGACGCACCCACCACAGGGTAAGTATCAGTAGTTCGGCCAAATTTCCCGCATTCTTTGGTTGATCCAAAGTAGCATTCGACAC
GAAATAACACTGAATTCATCTGTGATGACGAGATGAACATTTTCGTATATGATCTTGCAGCCTATTGAGAGTTCAGGCCCCTCCTTTCATAGTTGCTAAA
TATGTATAAGGAGCTGAAAATGCACTGCGCGAACAAGATGTAAATTCTAGAGCAGAGCAGGTTAGTCGGCCTTTGATATCGATGGCTGCTGTACCCTGAT
GGGCTAATAGAAGGACATGATTTTGTTGTTCGACGCGATGCACAATGCTCACCGAAAAGAATATGTACATACTTCACTATGTGCTTAATTAACCAACTTT
TCCCAGACCCCCCTCCTAGTCATAAGCATCGGCGAACATTCACTAGTGTCTAGAAATGAACGAAAACGCCTACCCGATTGACGCATTACTAGCAAATAAG
GTACCCATTGTGATTCATCCATAATGTCGCATATAGTGACCTCATCAGTCCTGCCGACGGGATATTTGTAGAGACTACCTTTCCGTACCCGACCAAATAC
CATGTCTTAATTAGTTTTAGTTTCTTGCTGATATTTTATCCAGGGTTTGACATGGTTTTAAAACCCTCGTGCTTTTTCAATATCAGCTGCAGTGTAATTG
TCCTTTGTTGCCCACGTGGTTCCGATCGAATTATTCTTACCCTCAGGGTTAGTTGATTGTACTTGTGCGACTACTAACAATATATTCTGATGCTGGAAAA
AGGTCGCTGCTTCATGTGGTCGAAAGTCTTTTAAAAACTAATTATTTCTTTGCCGTGACATAATTAATTGTGGTTCCTCTCTTATCCCGCTATTCAAAGT
TTTTTCTTGCTCGCTCGCGAACAACTAAAACACTCCTCATCGGACTCGGGTGGGTCTGATAGAGACCGCCACTGCGTATGTTAAAAGATTTCGGCAAAGC
ACAAATTTGGGTTAGTCGAGTTCTCAGCTGTCCAAGGAGGAGCCGTGCACGACATGAGGAGTACAACGAAGTTTGATGTACCCGTTTGAATCAATTTTTT
TCCAGCGTGCGGAGCTCACTTTAGTAGAACAGATACTATCTACCAACTCGTATTTTCCGGCGAATGTAGCCAGAGTCACTTCGCCGAAAGGGGATATCCT
AGGACGAGCCATATATACAGCTTCTACTTTCTCTATCCATGGTCCTTTAGCAGGTGGACACTCATCATTTAGCTCCCAATCAGATGTTCAACTATAAAAT
ACCCCATTCTATGTCTCATTACTTTTAGTCGGGTAATTTGCCTCGATTTACCATATAGAGGCCGTTCTCGAAGAAGTATATAGTATGCCTGCGCACTAAC
ATCCCTGGATGACAGCATGTAGTGAGCACGAGGTATTCAGCTTGGTTGCCGCAGCTGCAGTGGCCTCTGAGCAAGGCATATCCAAGGATATCCAGTTCTG
GCGACTGGCGAGAAGTTAGTCGAGGAGTGATGTCTCGGTGTTGTCACAAGTGGACCCAAATGTATCTGACAGCTGTAAGACGTGGACAAAGGGTGCAGCT
CTGTATGTCTCGGAAAGGCAACAAATGCTGGACCGAGTAGTATAAAGATCTGGTATGGTCAACTACATGACGTACATTGTCAGGGCTGTGTCGTGAGCAG
GTGGCTTTTCCTTACACCAGCCCAAATCTCTGGGAGAACGTGTTAGTGTGAACGAGCTGGTGACCACCAGACTCATGATCTCACCACGTCTCTCACTTTT
TATTTGGCTAAGTGACCAACACATCAATACACTTGACCCTATTTCCGTGCGGGTTGGTCCCCGCATCGACTGTCTTCAAGTTTTCGGACTTCAGATCCGG
GAAACAGTACAAAGAATTGTTTTGTAGAATTACCCACTCCTGCGACGCTGTCAACCTTTGCCCATACCACACAGTGAAACTGAGGCCATTCCAAAACATC
GACAACTACGCTAGACGTGATCTGAAGAATCGTCGGTGGACCCTCAACGACCCAGCTGGCTGTGCAAGACGATGCGAGCTGCTGGCACGGACGGACCAAC
CGGAGCCGCCCCACTGCTTACCCCGATCCTGCCGCCCATGATCGGGTCAGTCTCTCATGAAGCACTTGTGAAGTGGAAGCGGGATCGACACGACAACGAG
TCGAAGATGCAAGCACGCTACCGCGTGACCGGTGAAGACTTTGCCGCCGTGGTGCAGTCAATTCGTGATCCATCCGGGCCTCATCTACTGGATGCGTTCT
GCGAGGTACAGCTCAACGTGGAGGCACCGATGGATGTTGACCGCGTAGATCGAGCATATTGTGTGCAGCATCAAGAGCGCTACGCTACCGGACATCAAAG
AGTTGTTCAAGAAGGAGCTGCGTATGAAGAAGGATGCCTGCGACGTGAATGCGCGACTGATCGATTATTTCAAGAGCTTCAGCACTATCATCGAAGACCA
TGGTTTGGCGGAGTGTTTCAATGGAGTTCTTGACACGAACGAGGAGTACAAGCGGTTGATTTCGGACTTGTAGCCGTAGTCATTGAATGATGAAATGAAA
CAGTGCGTTCGCTTTACTCACATGGAAGCTGCGAGGGGCCCAATACGTTGTTTAGACTCATTCTAGAAAAATCGACGGGGTTGGAGCGACAACATCGGCG
CCTACGTCTGCAGACGCGTGAAGCGACCGGATCAGGTAAGGAAAAGCCGAAAATTCATCAACCGGCAAAGCCGAAATGGGGTTGGGAACAGAAGACGCCG
GCTGCGCCGACGACGCTAAGACCAATAGCGACTGCGAGCTGGACGAAGACCGACAAGTAGTTGAAACCTCTAAGTTCGTCGAAGCCTCCACCAGGACCTT
GCCGAAATTGACAAGAGATGCATTGATTGCGTGACTGCTCAACTGCCTCCCGAAAGGACAAGGAATTTCAGGACGAAGATCAAGGATGCACGCAACAAGA
AGGCCAAATTGAAGTGACTTGGAGAACTACTGCCATCTACTGATCGTGTGGTGACGTTGAACGAAAGGGTAGAAGTACAGTATTGCCCCGACAGTGGATT
AGACTACCACACTCGCATTGGAATGAGTTGAACGCCCTGGACCCCAGTGTGGTTGCAGTGGAGCTGAAGAACCCAGTCCTACACCAGACCCTTGATTCTA
CGACGGTGGCGGCCAAGTACAAGGCCAAGATTCACGTGAAGATTCACACGGCCGTGGGCCTGGTGAGATGATGGCTGTACTGGATGTTCTCGTGGTGCCA
GCTACGCGATGTGATGATGAGACCAGTGGTGACCCGATCGACTAGGAGGCGGATGAGATGCCTGCCAAGATCGACGGATAGGAACCAAGTGGAGATGATG
ACATTTTCGCGGCTGTGGAGCGATTGATTGATCAGTTGATGGAGAATGGATTTCCGTTGGAGCATGTGGAGACATTGCGCACAATTTCGCTCGCATACGA
CGTGTAGCGCCTAGAATTGCGTGATGACCCTCCTGCCAATGTGCCGCCACTCGAATTGCATTTGAAAGATAGGTCTCGTCCGACGAAGTGTTAGCATCGC
AAATATCCTCCGCACGTCCAGCACTTTTTACGGAAGTGTAATGATCGTCTTGTGGAAGTAGGACAGGTCCATGAGAACCCCAAGAGTCGATGGTCGAGCC
CCGTTGTGTCTGTGCAGAAGCCTGCAAACCTGATGAAGTTGCGTCAAGCTACGGGCTACAGAGCACGGAACGTGCAGACCGAAGTTATGGCAACGGTGAT
GTCCATTCTTTCTCTAGCATTGGAGAATGCACGTGGAATGAAACACTTTGGTCTTTTTGATTTTCTTAACCCCTCATTTCCCGAGGACATGTGCAGATGG
TGACAAGCACGAGGCATGTCAGAGCCTCCTTCAAATATCTATTAGATTTTTCGATTAAATGCGAATGAATTCCAATGTTTATGCGAATGAGCCCTTAATC
TTTCGTACCCAGCCCCGACAAGTATATCCGACATGTGAACACATTTTAAGCAAAAGGCAGATCTTTCTTGTCGGTGGTGGCGGCATCACCGCAAACAGAT
GGCCCACGCCAACGCATAACAAGAACGAATGCACAAAATCGATCCACGAGCGCCAATGCTTTTGCAACAAAAAGGAGCGACAACAGCTATTGTGGCCAGT
GTGCAATTGCGTTTATCACAGGCCCTCAGCTTCAATTCCTTGGGTCGCCTCCTTTCTTCTCGCGCTCGAGGTGCTCTCCAGGACCTTCTTGTACTGTAGG
TAATCCGGCAGCCAAATGGCCTAGCCAAGTTTGTAATGCACGCCCAGGAAGAAAATGGAATGCCTCTGTATCACCGATGGGATTCATCACCCTTGAGCTA
CAGCTAGCCGTTATCAATGCTAGCGTCACCCATGTTATTTCGAGTCGCCTAGCCACACGATGTCTGCGTTGTGTGTGTTCCCCAAAGTGGCGTTGTTGAC
CTACTGCAACAGCTATATACCGGCCGTCTTGGCCGCGCATACGACGGCCGACGGAACATCGAGGTGATACGACGACCGTTGGTTTCGGTGTACGAGAGAT
TGAAGAGCTTACCGCTCTCCACGACCCCCATGGTGTACCCCATGGCGTACTTGTTGCAGAACCTCGCGACCGGATGCGGCTCCCTACGCTAGTCGTAGCG
CAACAACAGGTTGGAGGCGTGATCTCCCTGTCTTGTTAGCCTCATCACAACGCACGCACAACGTGCGGTGAGCAGCAGCGTGTTGCGGCTCCCTGAAAGC
GAACCACCACCTCGTTCACGGTGTCCAGATTCTTGTGTCTAAAACATACTTTTAATCTGCACGATGTCGGCATAGGGAATGCACCCATTCGCACACCGAT
TCAAGTCACTCATAGGTGCAAAAAAAGCCCCCTTCTTTTGCGGTGCAGCTTTTTGATGCCATCCCTACGTATGCATTATATGTCGATTGCTTATCCTAAA
TCATCGACATCAAAATGCAATCCAAACATGTCCACGGCTCCGACGAGGATATGTTTTTTTTGTGTCGGCACCTCCGGCATTGGTGAATGGAGGGTTAAAT
GGTTTTAGTAATTGCCTGTGGTCGAACTCTGTCAAGAATTCATGTTCTGCACGACCGATGCGACAATATTCACTCCTGAGCGTGTACCGCAAGGATGCGC
TGATGCTGCCATCCACTTCCAGAAGACGATGGAATAATGTTTTGCACGTCTCCTCTACATGCATCTGCTAATCTGGATCGATGACTTGCTGCTGCATGCT
GACGACATTGAGGTGTACATGCAGAATCTCGCTGAGCTGTTCTCACTGCTCAATCAGTTTGGATTGAAGCTGAGCGGGAAGAAATCGAGTCTCTACCAGA
CACAGTTGAAGTGGTGTGGGAGACTGCTTGATGAGCATGGAGTTCGTCACAATCCGAAGAGGATCGACACGCTACGATCACTGACATACTCAACGACTGC
TTGGGAGCTACATCAGTTTGTCTGTGGGATGAACGGAATGCGTGGAAGCATCGTTGACTTCGCACGCCAAGTTGCACCCCTAAACCACCGACTTCGTGAA
GATTTAGCAAGTGATAAGCACACGACGTGCTGCGACTGAGATCGAGAGCGAGTTGAGCAAGGAGGAGCAAGAAGCTTTCGACACGGTGAAGAAGATGTTG
GCAGCCACTGCAACACTCGCCTTCCCCGATGGTAACGCCACGACATGAATTCAAGGATGCGTAGGACGTTGGCTGGGCCGCGACCATCGGTCAAGTCAAA
GAGTAGGACCAGAAGCGACCAGCCACCGAGCAGCAACACCAACTCACCCAGGGCTTTCATGGGGAAGGCAGTTGAACTGGACTGTGATTGAGAAGGAGAC
CCTTCCGATTGTACTGGCATGTGAGAAGATGGATTACCTATTGTTGCGATCACAACGATTTCAAGTATTCTGTGATCACAGGAATTTGATTCACGTATTA
GTGCTGCATGAAATTGTAAAGAAACACACAAAGGCAAGTTGCTCAGGTGGGCGATGAAGCTAATGTATTTATTGTGGTGGAACACAAACCTGTTCCTGAC
AACGTCTGGGCCGACATGATCCTCGCTGGGCTGGGAGCCATGCCCCGGTAGCAACAGTGAAACGGATTAAGGTAGTGCGTCGCCAACCGACGTTGAGCAG
GCCACGACTGCCATCTCTCGATGAGACAAATTTCGTCTGACCTACGCTCGAGGAACTAACGATGGTCCAAAGACAATATCAAGCACCAGGGGAAGCAGAA
ACCACTGTAGAGGGCACGATCAAGATCGTGGGACGGATTTGGGTGCCGGCGGATGAAACCGAGCTGATTCAGAGGCTGTGTATTGTGGCACACTGTGGTG
GTGGGGAGGGGGGGGGCAAGGCCACCGTAGGCAGTAAGTCCATGATCGCGAACTTTGAGAATGATTGTTTGCTGTGTTTGCATTGTCGAAGAGAGGATTA
TCCCCCGACCCTGGGGCGAAGTGATCTACTGTGAAACACGCAATGAAGTTTTCAGCTTTGATTTTCTCTATATGGGAGCAAGCTATGAAGTCAGCAAGGT
CCTACTTGTACTGAAGGACCATGCTACACACTACTGTGAATTAGCGGATACGGCAGATAGCAGAAGCTTTGTTGGCTTGGCACTCGTGGTTTGGGATACC
GCCACAGTGGGTGTCGGAAAATGGAAAAAATGAAGTGGTGGCAGAGTTGAGGCGTCGGCTGTGTACGCAGCAGAAGTTTATGCCAGCCTACAGTTCATGG
ATAAATGTATCGGTAGAGCGAATGAATCGTGATATTTTACAAGTCATCCGAGCGGTATTTTTGACCTACCAAATGAGCTACAAGGCCTGGGTGTATTTGG
TTCCGACGGTGCAAGCAAGCCTGAACCTTGTCATCACTGGGATACCACAGGTACTCCGAAACACTGGAGGTGTCGAGTCTTCATCTTCATCTTGGTCTCC
AGACTTTTCTTCTTCATCGGGTTCGGCTCGGTGCGAGGAGGATACGTCTGGAGCACTTGCTTCTTCGAAGCCAGCTCTGTGGCAAACGGAGCGCGATCTC
CTGGCAGTATCGTCCTCTCCACTTGGCCGGTGCTTGCGCTTCCCCGTCAGCTTGAAGCTCGTTTGGCGCTGTTCGTTGTCGTCGAGGTCGAGAGCGTCGA
GTTCCAGCGCAGAATCATTGACGTTTTCATCTGAGGGATCCGCCGAAAGTCCAATGGTCGCCTCACCGAAGTTGACATCGCGACTGACAACCATCAGCCT
CGCCTCGATGTCATAAAGTCGATACGCCATGGACACATCTTCGTTGGTGAGGAACAGTCTGGCGCGAGCCTTGGGGTCCCGCTTGCACCGCTTTTCCTTC
AGCGTCATGATGTACGTCTGGCAACTAAACACACACATGTGCTTCACACTTGGCTTGCACTTGTACATGAGCAAGCGATTCTGGCCGTCATGGTCGCCTC
AGCCCATAACCACTTGTCCAACTTGGCGCGATGCAGCCAATCGTTACAATGGTCCGGATGGAGCGTTCTGCCGTGCCGCTGGTCTGGCGCACGTACGGAA
TCGTGGATTGCTGCTTGATGCCTTCGTCTTCGTAGAAGACCTTGAGCGAGTAGGTCGCCAGCTCACGAGCTCCATCGTGCTGCACAAACTTGAACTTCTT
GCCAAAATGCATCTGCACCTTCATGACGTACGTTTTGGTGCAGTCTTCGCTCTCCGACTTGCCACTCAGGCAGACATTTTTTATGCATCCGCTGGCTTCG
TCGACGATCAGCAGCAGATACTTGTTGCCATCCAAGAACCTTTCTAGCATGGGGCGCAGTAGAGCATATCCTTGCCCGTCAAAATGCCACACTCCGGTGA
GACCGCGAACGCCACTCGATCACAACCGTAGTCGAAGTTGGCATCGCCGTCCCCCCAGTGGGCATTATTGGCCCCGCGTCCACGGCCATTGCCGCCACGT
CTTGAGCCCCGATTCACGTCCTTCTACTTGGTCGAGCACTTATCA