Description :
From Genome Similarity Track
Location :
Scaffold_222:39189- 43728
Transcript NameFunction/comments
Pytap_DAOMBR444maker-pag1_scaffold_222-snap-gene-0.18Transcription initiation factor TFIID subunit 1

Sequence
4539 bases(100 bases per row)
GGACATGGCGATaCCATCGCGAACAAGGCCTTGCTGGTGAAaCAACAACAGAACCAAGTGGCGAGAGCGAAGGAGAGCAAGGGCAAGCCCATGCGTCGTT
TCCAGGCATCAACAGCTTCACCGTTTGCGAGTGCACTACGTGTTGATGGTGTCGATCCTGTACACAGGCAGGATGACGCTGACCgCGATGAGCTGTACGT
GAAAGTGCAGCAAATAGCATGGGAAAAAGACATCATATGGGGGATCGACTTCGATGCGAACAATCGCAAGGATGAAGGCGCAACCATCCCGGTTGAAGAA
ACTGAAGATGATGTTGCCACTACCAACGAACACACACATTCTTCACCATTTGCGAGGAGCTCAACATACGACGCAAGTGGCAGAGGTCTCAGTtcACGTC
CACCTCAATtGTCTGTCACAACGGTCTCGTCTAATTCTTCAGGATCGTCTGGTGCGAAGTAcGTAtCTCTGACATACAAGGAAAAATATCCGCGACGGGC
AATGTCAACTGCGGAgACGCCATGGGTTCCATCCGCGACTGAAGAGAAATTTGATGTGATGAAGCCTCGTCACTACCGGTGGGAATtCCCAGATAGTGAG
TCACTCAATGCCCCcACATCCGGAAAaTCGGATCACAAAGCGGAAGAAAAaGGATCgTCCAtCcTTGTCTGTCCGCTCAATAAGGAGCTAAATGATGGAT
CTTGGATTACagCAATCGGTTGGAACTCGACACAAGACATGCCGGAGAGCAGGCTCATTCTCGATGATAATGACGCGTCATTAATTTTGACTGTCCCTGA
AATGGACGATATCCGTCCAACCCTTCGAATTCCAGAAAGAAAGTTGGGTGCTGCAGAGATCCGCTTGGAGCAATTAGACAAGCAGCGGAGAGAAAAGAAa
CAGCGTATTGACGCTGTCATGGGAAACTTGGAATTCGGTGATGAGACAGCCGAAGGACGATTGGGCACTGAGGGTACAGGCAAGAAGAACAAGGAcAGTC
GAGTTGTGAAGAATATCGGATACGTTCATCATTCGTTGCCAGCGATCAAGCTGTCGATGACGAAGCCTGAGCTACCCAAAGCAAAATTACGTGAATTCCA
TCGACCTCGAAGTAaTTTAAGATCAACGAGCGAATGGTATTTGCGACACCACCAGTAGTGCCAGCTCCACCTACAGAAGAAGGTGCGGTCGTGACTCAGA
TCAAGAaGAGTTCCGATCTCAAtCCgACAGCAGGTGGAAAGCTGATTGTGATTGAGTACACAGAGCAAAATCCTCCcATGCTTTCCAATCCCGGTATGGC
GGCACGCATTCTTCACTATTGGCGCCCACCTGAGCAGGAAGATGACGGCTTGGTCGGTAAAAaGAAGGTCAAGAAGGCTCGTCCAAAGGCGCCAGAGATG
AAGATGGGTCAAGTCATCACGCTCGGTAGTCATGATGAAACTCCGTTTGTGGGTGATGTGCCACCTGGCCGTGTAGTTACCTCCCTCAACTCAAAGCTGT
ACAAAGTGCCCATTTTCCCGCATCGTCCAGCGATGCCGTTtGCTCCGTCGTCgaCTGCTCGAGAAGGAGCTCAACATGAGTTGTtCCTTTTGTGTCGTGC
TGTTACAAaGGGGAAAAAaGGATCGGCTATTGGAAGCGACGGTGCGAAGACAACGCTGTACATTTACGAGATGCCAGACTTATACCTTGCTGGCCAAGTC
GAACCGCAAATTGAAGTCCCCGCGCCCAATTCAAGAAGTGCGAACGACTTTATCCGTCCGTACATGTCGTTTCATATCCTTCGGCTGTTCAAGAAGGCGA
GTGACGGTGAACGTCTGAAGATTGAAGACATCGCACGCGCTTTTCCTAACCAATCAGGAACAGCAaTCCGCAAACGAATGAAAGAAGTAGCAACATTTGA
ACGTGGTGGTAACGACTCGGGCTGGTGGAAGAAGAAGCCTGCATCTCAATTGACCAGCGAGGAGGAGATTCGCGCAAGTATCACTCCTGAGTCGGTTTGC
CTGTACGAAAGTaTGATGGCTGGCCACCGCCGTCTGTTGGACaTCGGTCTGACCAAACTTTTTtGtCCCCAcGGGCGTCAATGGAGCGATCAATCTGCTC
ATCAAGCGGCTAGAAaTGCGTAAGCAAGCACTGTCTGCTGCACTTGTTGAGCCCcTGAAGCTGGAGAGACGCGCTAAAGAGAAGGCaGAGCAAGATATAT
GGAAGAGAGATGCCACAATTCGCAAGCTcgAGACGGATATTCAAGTCGCTCGTTACATCCATGAGCAGCTCCAGTTGACTCCTTGGAATCTCACTAACAA
CTACGTAGAGTGTCATCTCCAGGGTAAAGGATCGGGCATGTTGTTACTTGGTGGCATCGGTGACCCTACTGGAAGAGGTGAAGGCTTCAGCTTTGTCCGA
GTTCCGCAATCTCGAGCGAAAAaGAAGGATGGCGAGGAAGAAGGAGCTGCTGGACCTGGTGCCGAGGCTGCTGCTGTTCAGAAGGCAGTTGCGGCAGTAA
CAGGTACAACTGCCGATCTTCGTAAGCTGAAGATGAAGGAAGCTGGTGATGTTCTTCGAAACcTCGGTGTCGCAGAGGCTGACATCAAGAAGCTCCGACG
TTGGGACAgAaTTCACATGGTTCGAGAGCTTAGTAGTCTGGCGACTGCTCAcGGTCGTGCTGGTGCCTTGaGTAAATTCGCTCGTGGTGCTCGGAAGTCA
CTGTCGGCTCAACAGCAAGATTATCGCCGAAAGTGCGATGTGATCTATGAGCGTCAGATGAATGTCCTTAGTGCCACAACGGTGACCTTCTCGGATGACG
AAGAGTCGGGTGATGATTCCGATATTATCGATGAGCTTGAAGATGAGCTCCTTGGTGCTGGTAGTTTCGGTGGTGATGATCGAGAAAAAATTGTCAAGCT
TGGGCCGAAGAACTTGTTTACGAAGGGTGGCGGTGGTCTCAACCGCTCCAAAGAAGCTTTGGCAGAGAGAGAGGATGCCGTAGAATTAGAACGGCTGATG
AAGGAAaTGAAGGAAGACTCAGGTGCGACCAGCGCCATtCgtCGCCcAGACATCGATGCAAGCAACCTTCGTAATCAACTCCGTGCGAGTGGTATCAAAG
AAGGCTCCTCCGCCTCTGGATCCCAGACACAGGGTGGCACacGACCTGGTTCGTCTCTTGGGATGTCCCGAGGTGGCTCGAATGCTCCGTCGGCAATTCA
CACGCCAATCGAACACCGATCTCGAGCTTCGTCGCCAACGAGTGCGTctAGATGGGCATCGGCCACTAATACACCAAGTACACGTGTTCCAGGACGCAAG
GTCCTCAAACGAACAACTCGTGTGGTCGAAGAAGATGGAACGgAGACAGTGCGGATTGAGTTCGtCGTTGATGACAAGCAAGTAGCTCGGTTCATGGcGA
AGCAGCAACGCCAAGAACGCCAATTGAAAGCCGACGAAAGAAACCAGTTGCGTAAACGCAAGCGAATGCTTGCTTTGGAGGATGACTCGCCGGGTTCTAG
CCTTCTAGACAAAGCGAAGCGTCGcAAGCAGCTACAAGAAGAATTGAAGCAACTACAGAGAACTGAAGAGCAGAACAAagATTACGTCGAGAGACTTGAG
AAAGAAGGCGAAGCTGGCCTTGGTGTGGGTGGAACTCCGCAGAAGGGTGCTGTACGGTGCACTCAGTGCGGTCAAGTTGGCCACATGCGTACAAaCAGAA
GTTGCCCGTTGTACATGGCAGATGGTGGCGGTGGCACAGACGGCCCGGTCAAATTGAAGATGAAGAAGGGTTCAGATGATGTGGGAAAGATCACGGTTAA
CTTGGCCGAGCTGCGCGAGGGAGCACGAAAGCACGAGGCGGAAAAGAAGCGCAAACGGCTGCAGGAGGTGAAAGAACAAGCTGAGTTGTAtAAGCGGCCT
TACACGAATGCTgCGGTAAAGCAAAGTCGATCTCGGATGCCTGTaTCTCATCTAAACGGAAATCTTAGCGTCATCATCGATAAGCTCATCGACATGCCCG
AAAGCGAGTTGTTTAGAGCTCCAGTGGACTCCGAGCTCGTCAAGGaCTATTACCAGATAATCAAGCAACCGATGGATTTGAGTACGATCAAAAAGAAGAT
CCAAGAGATGCAATACGATTCCATGAGAGACTTCATCAAAGACTTGGAGTTGATGGTCAACAACTCGAAAGTGTACAACGGCGACCCAGCTCGATCACTC
ATCACTGCAAATGCTGTCAAAGTCTTGAAGCGCGGACAGGAAGAAATGGCCTCTGTGAATGCAGAAGGCGGTACCCCCACcACCGCGGATCGCGGgTAGC
TCTATCAAATAAaTGTTGTGCACAATTCGCATCTCTATTGGAATCGGTTGTGTGTATGTAATGTACGGcTAGACCAGACCTACTGGTGACTCATtcgtcg
agcaaaaccatacccaggaacacaaccgatgcacacagcagactgtagccgattgtctgctggtgggcgtcgatgaaGTCgttgatagcattcaagagtg
agggtgagtggtgccaccacaggagcgttctttttgggg