Description :
From Genome Similarity Track
Location :
Scaffold_121:39183- 43387
Sequence
4204 bases(100 bases per row)
GAGTTCGCTGATGTCTTTCCTGACAAGATCCCAGCTGTTCTACCGGCAGATCGCAGCGTACGGCACGAGATTGATCTCGTGCCCGGATCCAAGTATTGTG
TAACTCGACAATGGCCACTTCCACGGGATCAAGTTGAAGCGATTGACGCCTCCTTTAAAGGGCGCCAGCAGGCGGGTCATGTGCGTGAAAGCACCTCACC
TCATTCCAGCCCTACGTTCTGCGTCAAGAAAGCGACAGGCGGATCGTCCACGCCTACAACAATCTTCACGACGCGACGATATCAGCCCAGACTCCGATCC
CTCGTAAAGACGTGGTTCTCAACACCATGTCTGGAAGTACCATCTTTTCTTCGCTGGACCTCACGGACGGCTTTTATCAGAACTTGATGCGTCCTCAAGA
TGTTCCTCTCACTGCTGTGAGCATGCCTAGCGGCATGCTATGGAAATGTCTCGTGATGCCGCAGGGACTCAAGAACACCCCTGCTACCTTCAATCGGATG
GTGTCGCATGTGCTCCGCTTATTCGCAACTTTGCCCCAAGCTACTTTGATGATATCTTCGTACATAGTCGCGCCTCTACCGGCACGACCGACCTCACGGT
CCACCTTGGGCACCTTCGACAAGTCTTTGAAGCGATGCGTGAGAACAAGCTCTACGCCAATTTGAAGAAATGCATCTTTTGTGCACCGGAAATACCGGTG
CTTGGTAGCTACGTCAGCGCGAAAGGGGTTCGCGCTGACCCGGAAAAGATCTCTTCGATCTGTTCATGGCCTGTTCCACAAGAGCAGAAACATCTTTGCC
AATGGTTAGGTCTAGCCAACTACATCCATCATTACGCCAAGAACTTTGCTGCTGTGACTCACCCATTGTATCAGTTGTTGAAGAAGGACGCCACATGGTC
GTGGCGTCAGGAGCACCAAGATGCTTTCGACGAGATCAAGAGAAGACTTTCTACAGCGCCAGTGTTGGAGCTACCAGATCACTCGAAACCATTTCATGTG
GTCTGCGACGCGAGTGATTTCGCTATTGGATGTGCTCTCATGCAACATGACAGCGAAGGCACTGAACGAGTGATCGGTTATCAGTCGCGCCAATTGAATC
CATCTAAACGCAACTATCCTGCGCACGACAAGGAGCTGTTGGCTATGAGATATGCACTCGTCAAGTTTTGCGTCTACCTGCTTGGAGAGCAGACGTTCGC
ACTCTACACCTACCATGTCTCTTTGCGCACAGCGACACAGATCCCCCATCTCATCCAGCGCACGGCGCGCTGGCTGTCGTTTTTCGCTGAGTACAACTTC
GTTGTCCACTACAAGCCTGGTTCTAGCAACATCCTCACCGACGCTTTGTCGCGTCGGCCTGACTATGATCCGCGTTCTACTGTCCCGGTTCCTGTTTCGA
CCGATGACAATCACGATGAATGCGTTACTTGTGTCGCACTCGGTGTGAATGCAACGCGGGTTACTGTGGTGAACCCCCTTCGAGTCGACAACGCGGCAGC
TTACACCCACGATGTCTCCTACGCGCCGATCGTTCGGTACTGTCGTGATCCATCTGATGTGACGCTGCGCAATCTCACAGCGTCGGCTCGAGCCCAGGTT
TCGGGTTACTCACTCAACGGCGACTTACTCATGTACCAGATCGATCAGTTTGACCCTCCTCGCATCGTCGTCCCACTCGACGACGATCTACGTGCTCGTG
TTCTTCACGAGCACCATGATAGTGCAACTAGTGGTCACTTGGGCCGAGAGAAGACCTATCTGTCCCTATCTCGCACGTTCTACTGACCCCACATGTATAA
GTGGGTCCGCAAATGGGTACGCTCATGCGAGGTATATCAGCGCGTCAAACCGAGTCCATCTTTCCAATCCCCATTGTGCTCTCTACCGGTGGCGGCCGAG
GCATGGGACTTGGTCAGCATGGACTATATCTTTGGTTTTTACGCCGATGCGCAGGGGCGCACCGGCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GGAG