Description :
From Genome Similarity Track
Location :
Scaffold_421:39170- 45920
Sequence
6750 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTATGGTTAATGTCGCCAAAGCAGCCCGATGGAACTTCGTGTGGTGTGCTGACTATTGCCCAAGTTTATTC
CGTGTTGAAGGACAGCTTCCAGCTTGCACAAGGTGCCGTTACAACAGACGATATCGCAATTATGCGGCTTCGTATCATGTGGATGATAGTTATGCAACTA
CACCTTTGCCAGTCCAATTTGGCGACAGTGTAAAGCAAAGTGGAACGTCCCGTAATTAAATTTTTTTAATTTTTGATTTTTTTTTTTTAGAAAAAGCCTG
TCATGCAAAGTTGATTTAGTGTAGTGCAAAACTTTACGTGCCGTACTCCATAGGTTCGCTACGAATAGCTGCCGCCACTGACAACGCACAGTGGCGCGCC
ATCTTGTTAACCAAGCGCAGATCCATACATGGCAAGCTATGCTCTGCAGCGTTTTCAAGCAGCTGCATCCGGCGCTCTGTTTTCTCTCCGTGTGGAGCAA
GAAACATTACGTCATGACTTAAGGCAAGATAAGCCTTAATGCGTGCTTTTAATACACGAAAACACCCTGCCGCACAGTAAAATAGACACAAATGTTAGTA
CATGTGCACGCTATAATTGTCTGTAAAACGTACCCTCAATCGGGTTACACATGGGGGAGTATGGCGCCAACCGCAACAGCTCCAAGTCCTCCTGCTCAGT
AATCAGATCCTCAGTCTGGCTATGAGCCGGAGCGTTGTCTAAGACAATGACAACCGTCTTGCCAGCGAAGTGGTCGCGGTACACGTCGTGGCGCTTGACG
CTGCACGAGCGTGTATTGGCAGTTATCCTCCAGGTATTCTACGAGAGCCTCCTCCATCTCCGGCGTGCACTTAGTGCATGTCGCCCGCGCGCCGCCTCTC
TTCTTGATGTCCGGGGTTCCTCGCTCGACGATAGTCCGAGCCGTTGTAGCTGGAATTCCGTTGCAATCGGCTACTAAAGCCCAGTCCTGCCCAGCCTTGT
GTGCGTCGAGAACGCGTGTCCGGGCCGCGAGGCCATGCTTTGGTTCTGTTGGCATGATGCCAGAAGAAGAGGTTTTGATGCCGACCACCAGTTAGCTCTG
CACTAAATCGCCATTGCTCTAAAGTCAATTTTTGAAAATAAAAATTAAAAATTTCTTTGTCACTTAAGTTACTTCACACCGCTTTGCTTTACACTGTCGC
CGATTTGGACTGGCAAAGGTGTACATACGTGCGACGAGGCGGTGCCACAAGTCATTGATGTGCGCAGCGAAATGCGCCTAGAGCTACAGCGACGCAGCGT
CAGCAACATGGCTACTTCTCCACCAGTTGTCTGGCAAGAGGTGTACGACGGGATCAAGCGCTGCCATGCTGCCGCTATATCCAGCGTATCGAGGATATCA
AACACCTCCGCCAGAAAGCCCCTCAGCATGCCCCACCAGCGACACTGGAGATTCCTGAAGACTACAAAAGGTTTGACTAGATGCAGATAGAACCTACTAA
TACAATATTCCCATGTGTAATTGCTCTTGTGAATTATAGATGAATAATTGAATTATATTGATAAGACAGTAGAAAACTAGTAACGTTGTCCTAATAGGAC
AGTGCATGTTGGGTTTGATGTTGTCCTAATAGGACAGTAGTCTGAGTTGCTGTGTGTCCTAATAGGACATAATAAGTGTCGAGTTGTTGAGTGTCCTATT
AGGACACACGGAGCCTGGCTTGTTTCGTCCTAAAGCACATTGTGGTGTCCTAAATATTGGATCGTTTATGAACCGATTGCTAGTTTTTTATTCCAGGTTT
TAGGACAATAGAACACTTTAGGACACCTAGTAGGACGCATTCTCTCCTTACCTGAGAGGCGGTTTTAGAAAAGCATCTTAGCTTCTCGACCAGCAGGCAG
AAATATTATAATCATCTCGATTCATTTTTGCCGCGTATCACTAAGCAACTAACGGCTACTATGAATCACAGCACGATATTCGTTCCCAAAGACCTTTTTA
GTAGGTAACGACTTCAATCATACCGCAATTTATAAATCGGAGCACCAGACTGCATCAATTCGTGCAGTAATTAATTGGTTAAAATGCAAGTAGGCTGCAC
ATTAACGCGCGCCTTAGCACTGTGAATAATAGTGATTAAATCAAGGCTAAGCGAATACTTTAGTCGGCACATTCTCGTAGTAAAAGGTTACCATTTCATT
AAGAAACACTTTGCCTGAACCTTTATTTGTTGATAGCATTAATAATAATACCCGTAAGAGCGAGGGCATACTTGCAGTTCTAATCTAATTTAGAGCGCCA
CAAAGGGTACGCACGCACTGCAAATCTTGCAGTGCCAGTGTGCATGTATTGCTATGTGCGAGCTCACGAAGGCGAGTCGTCCGTTTTTACAAGTTTCATC
GATTTAGCAGAACTTTGCCATTTACGAGCTTTGGTCGACACTGCAGCAATCGAAGGAGCTAATGCTCGCAAAATTAGAATTTTGGCGCGTAAGTTGGAAA
TCAGCATCATCCGCCTATTTTAGAAAATTATCTGGATTTGAATTCGACGTAATTGCAACCTTCGTCGATATTCGAAGGCTATGATGGTGAATTAAGGAGC
CCCCCAAAAGTACAAGAGCTATTATCCGGTATGCCATCCTTGCATACAAAGTGATAGCCATCAGCGATTTTCGCTCGTTAAATTGCTCCAACCTGCTATC
ACTACTTCCGATCACCATTACTCATATTAAAAGAATCCAACCTTCAAGTCGTAAATACCGATTGGATTCTCCATCACGCCTAGTACCCATGTCCAGTGGG
AAGAACACACCGTCAGAAAAAGTAGGTGACATCTCAGATGTAGCGCCTGG