Description :
From Genome Similarity Track
Location :
Scaffold_634:3917- 4954
Sequence
1037 bases(100 bases per row)
GTACCGCTTAAGACGTCCAACATAGAACGTCGGGTGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACCGCAAAA
GGTCCGATGAAGCGGTGCTTCAGCTTGTTGCTGCCGACAGAGCTGACAGTGTCAAGAGATAGGTTCCTCGTGTCTAGCAACACCACGTCCCCAACCTCAA
ATATACTTAGGTTTCCTCTTCCATGTTTGTCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGCTCAGCTT
GGTATCCATAAAGGATGCCACCTGTTTCCGCAGCGAAACTGGTCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCCCCCCCCACTTAGAAT
AGAGGAGTCAGTGTCTCCTCGAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTG
TTGAGCGCAAACTCAACAACTGGAAGCTGCGTCGACCACGTACGTGGTGCTGCCGCGCACACACTGCGCAGAGTGTCCTCGAGCACTCGATTGACGCGCT
CTGTTTGGCCGTCTGTCTGCGGATGATCCGCAGTGGACATCTGCAGGCGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAATCCGCG
GGTCTCGGTCCGAGACAATCGTCTCCGGGAGACCGTGATAGCGGAGCACGCCATCGACGAACAAACTTGCGATTTGTTCGCCCGTTACAGTGACGGGAAC
TAGAGCAAGATGTATCATCTTGCTCAGCCGACACACAACACCAAAATTTCGGTGTTGCCGTGTCCGTCGGCGGGAAGCCCAAAGATGAAGGCAAGACTCA
TCGACTTCCAACAATCAGCCGGTACGGGCAGGCTCTGTAGTGGAGCCGAAGAGTGCCCTGCGGGTTTGACCCGCTGACATGTTTCACATGTCTTTATGTA
CCGGGCGACCCACTTGTACATGTGGGTCCACCAGAAG