Description :
From Genome Similarity Track
Location :
contig_93:39169- 40639
Transcript NameFunction/comments
g10762.t1hypothetical protein PHYSODRAFT_499593
g10763.t1hypothetical protein PHYSODRAFT_345983

Sequence
1470 bases(100 bases per row)
CGCTGCTGATTTAGAGAAACTGCACCTTGGTCCGTAGTTGGTAGCGCACCAGTAGCGTTAGGTGATGGCACGATTCGATGGAACACATCAACCAACCTTG
CCAGGACTCAAGCAATCACAAATTCCTACGCAGCTGCTGTATTCATTGTTTAGAGAACCCCACGGAAGCACATGCAAAGCAGCAAATCCAATTCACATTT
CAAAATTGGCGAGCGTCCATCGCGACAAACCGAGCGATGCCATTGACGATAGTGCCCGGGGAGAAATGATACACTAAGCGCAGCTCCCACGCCGTGCCCA
TGCCGTACTGTTGATAAATATCTCGTAACGTCACGTAGTCCTCCAGCTCCTGGTCGCACTGCAGGTCCTGTCGGATGGCGATGTCCCCATTCTTCCGCGC
CTTTGTTGCAGCACTCGACAGGCCGCTCAGCGTGCAGTTGACGGTCGGCAGCACGATACACATGTTACCATACGACTTGAGCTTCAGCAGGGCAGCGAGA
TGTTTCTTGAGGTGCCCAATTTTCAGCTTGGACATGGTGACGAAGAGCGTGCGCTCCAGCTTGGGCGCGTTGGGCTGCTCATCCTCGTGCAGCAGCACGC
GCAGATTCACGCGTCCGGGAGCCTGCGACTTTGATGGGTCGTGCTCTTGGCTGTAGACGCAACTTTGGGTTTCTTGCGAGCACTTTCGTCCTCGGAGGCT
GCGGCAGACGGCTGCACGCTGTCACTAGGTGAGCCACCTCCGGGTGAGCTGCGCTTCTCGCCAACAGGTGGCGACGCTCCATTCGGCCCGTTCGACGGAG
ACGAAGGCCGCGACGACGTGGCCGAGGACGTCCCCTCCGCTTTTTTGCGTCGACGCGAGGCCGCCTGGCTCAGCACACCCATGCGCGTGCTCTCCGTGTA
GGCGTTGTTGAAGTGTCTGGAGCGGTTGAGCTGCTCGATGATCTGGTCCTCGTGGCGTTCGAACTCGGCCAGGTTGGGGTGGATCTTGCGCACGAGCGCG
TCGAAGTTGGGGTCCGGCCGCAGCGAGCGCTTTGACGGGATGTGGATGCGGCAAGACGGGCATCGCGCTTGCTATGGCGGATGGCCGTAGAGATGCACTC
GCCGCAGAAGCGGTGCAGACACTCCATGACCACCATCGTCTCCTTGATGATGCCCAGGCAGATGGGGCATGTCAGGTCCGCGTTCAGCACGCGCACCGAC
AGCGTCCGCGTGGCGCTCGGGTCCGTCACGGGCGCGCGCGGCTGGCGGTAGATGTCGAAGAGCGTGCAGTCGTCCACGAGCTCGATCTCGTCATACTTGG
AGCGCTCACTCACCTGGTAGTTGGGCGTGTTGCGCACCAGCTCGTCGTACTCCTCGCGTGTGAACGAGTACGGGTTCTGCGGCGGTTCCGCCATGGTCGA
ATTATTTTGTGGCGCCTAGTGTTTTTGCTAGCCATCCTGTGCGAGTGAATAATTTGAGGTTTTGTACGTA