Description :
From Genome Similarity Track
Location :
Scaffold_20:391677- 397791
Transcript NameFunction/comments
Physo_132337hypothetical protein
Physo_132338hypothetical protein

Sequence
6114 bases(100 bases per row)
AGCACCTCGTCCGACACGAGTCGACCTCCAGTCACACCGCCGTGACCGACACGGCCCGACAAGCCCCAGCTCCGCGCTGCCAGTTCGATAGACAGATTTT
TCAAAGCAACTAATCTATTCTGAGTACCCCTTAAGGCTACACACAAACTTACACTTTGCGGCGTGCTTTATTTTACTGCAGTTAGACCAACGATTACCGC
CTACGACGGCCGTGACGACAGGGCGAGCTCTGCTTCAGCCCCCCCCCCCCTCATACCAGATATATTTCTCCCTGTGCAACCGACGGCTAAGACTAACCCC
ACCTTTCGAACCATGAGACCACGACTATTGATCAAGCGCGGAATCTCAGCTTCGACTGTCGTCGAGCAGGACAGTTTGAAGAACTCTTCCACGAGCCCGG
CCTTCATCAATAGCACCACAAGCGACGATCTGCACACGCATCCATGACTACTCGACGACATCGCCAGGTCAAGATGCTGGACGCTCCGGGGATGCCTGTT
ACGACGACAAGAATGATAACCATGTCCAGCCCTACAGTGGGCACAACGAACACCTACAATTGCTATCTCGATCGCGGTTACACACACGATGCATGATGCG
CCCCAGCTATCTCGACCACTACGACAACGCCTGGGCTTCCCACGCGCGTATGCTGTTGTCCCGACAACGAAGCTTTCGAGTATCCCTGGTGTGACGACAA
AAAAAAACTGTGCTATCAGTTGCCGGTCAAGCTGCGCGAGTAGCGACTTCGTTCCCAACCACTATTCGAGACGACGCTGACTAATCCAGTATCAAAACGC
ACGACCAAGTTATCGCTTGCTGCACAAGCACCGCAGCGGGCTCCAGCACGAGCAACCGTCTCGCTTGCAACAATCGGTACACCCGGCATCTACAACGACA
CGATGCGGCAACTCCAGCGGAACTGCTGTAGCAGTGGACGCAAAAGTTCCGCAAGAACCCTTTCGGCAACAACACGCACTACCATCCACGTCAAACGTTG
CATGGGGAGCTACCGACTACGCGTGCACGAACGATTCCCATCCGACAAAGCGGCCACCGGCCAGGAGCTAGGAGTTCAACGACGAGCAGTAGACCCTACG
CGCTCCACAACGCCTCCGCGACCATGACTATTTCGACAACGACAAGCAGTAAACACAAGACTACAGTACTCAGGACAGCAACGGCTCAGGCATTTCGGCT
CAAACTTACTGCTGTGGCTTCTACAACTACGAACGCGCCACCACTGCCCCGATCCGCTAGCAGTACGCACAAGACAATCGGCAAGGGCAGCCACTACGAC
AACAGAGGCAAGCTGTAAGTTCGCCTTCAGTACCTACAACATCGGCAGCGGGCTGGCCGCGCAGTTCTGTTTGTTTTTACTACGACTACGACTACGACTA
CGATATCAGCTGCCAGCGGGGCAGTTCCGATCTCTTCTGACGACTACGACTGCGAATCCGGCACAACGCCATTAGCGCGGGCTGTTAGCACCGCTTGTTC
ACTATCGACGGCTACTCGGTCTAGCTCGACTTCAATGACTGCGACTGCACCAGCGGGCTTTACGTTCTGTTCCGTTCGCTTTCGGTGACTACGACTACGA
CTCCGGCAGCAAGCTGCACGTGCAGTTTCGCCCGTCTATTACGACTAACTGCGACATCAGCAGCGGGCTCTACGTGGGGCTCCGTTCACTTTCACCAACT
GCAACTCGGTATCGATCACTCTCACGACAACTATTACGACGTCGGCAGCGGCCTGGACACGCAGCCCCGCTTGCTGTCGAAGGCTACCATCTTATTTTCG
TCCCTGCACTACGACTACAAGTTGAACATCGGGCTGGTCGTGCCGCTCCGTTTGCTTTCGACGCCCTAAGAGTTCATGTTGACCGGCTACTGTGACTACA
ACCACGACATCATCAGTGTGCAGCTCCGTTCGCATTCGACGACTACGAACTCGCAACCTCGACTATAAACAGCGACAACTACTACACCCGGGATCGTCAC
GAGCAGCGCGCTTGTCAACTTGTCCATGTCTCGCCTCCCAAACACTCTTCATGGGGCTTTTGGCACGCTCAACGTGCTCAACTTGCCAACGCGCATGTCA
CCACGGCACATTTGACAGGCATCTACCGATTGGGGTAGCTTCCCGTGCGCGGTGCCAGGGACGACTTCGACATCGAACAACGACTTCGACAGCGACTACA
AATACGACAATATCACGTCCATATCGATGACCAGGACAACGACTATGACAACGACAGCCAGAGTGGAAGCATCCATGACTGCGACCATGACTACAGCTTC
GACGGCGATCACGATGACGATTACACTACTACAACGACCAGGACTACGGATACTTAACCAACCACGACTACCGGTACAACGCAAACGACGCCTACGACAG
CCCACGACTACATCTACTGCAACGACTCTGGCTACGACAATCCGAGCGCATACGATTTCGAGCACAAGTACGACTACGGCTCCAGTCACGAGCACGATTT
CTTGGCACTCGACATCTTCGGCACTCGACGACGACAATCGCCTTGGGGGATCTCGCCATTCAACGTGTTAGTGGGCCAATATTGGGGGCTGCCATTCGGC
ACCTTGCCTATCAACCAAAGCGCCTCTAGCTTTGGCCCATTAACACAATGAAAACTCTTTAATCCCCCAATGCCTGGAAGCACCGAGGAAACTGATTATG
GCAATGCACCCGTGATCCCGGATGTTGGAGACGAATTGACCGAGAGCGTTCCTCTGCTCATTGATCCGTCAGCCAAGTACTCAGCGCCGGCCAAGACACC
GTGCTCCCCGACGTCTCCGGAAACGATCCGCCAGCGAACCACCCCAAACCCAGCTTACGGCACCAGCGACTCCCAGGACCCCGAAACCAGCCAAACCTAC
CCGACTACTCCTGACGACCAGTACAGCCCAAGCACCGAGGCTGCGGACGCCCAGCACTACCAGATCATCGAGCTCCCGGAGAAGCAGGAGACAATCCCCT
ACCAGCCGCAGCCCGATGTACCTGCTACGGGTGTATACTGGAACAGCGGAGGACGCGAGTCGGACCGGTTCAACGATGACAACGGCCGTGACAGGCGCCA
CCACCACCGCCGTCCCGCACGCACCGTGGACTACCAGAACTACGCGAAGACCGACACTCCGGAGGACACCCCCTACCAGCCGCAGCCTGCTACACGTAGA
CGCTGCAACCATGGTGGACGCGAGTCTGGCCGCTTCGAGGATGACAACGGCCGTGGTAACTACCACCACCACCACCGTCGCCCCACCCGCCCGAGGACAA
CCAGAACTACGCAAAGCCTGTCATTCCGGAGGACACTCCCTACCACCCTCAGCCAGCTACGCCATCTACGGGTAGACGCTGGAACCATGGTGGACGCGAG
TCTGGCCGCTTCAGCAACGACAACGGCCGTGACGGACGGCACGACCACCGCCGTCAACCCGCGCGTACTGAGGACTACCGTGGACCTGGTAGATATGATC
GGCCGAACCGACCGGGTCCGGTCGGTGACAAGCAATATGTAAAGCCGGAGTACGCACACAAGCACGACCCGAAGCCGGAGGACAAGAAGAGGGTGGGTCC
ACCTCGCGACGACCCCCCGAAGCCGCAACTTCGCTCGGCTGGTGGACCTGGTGCCTACCCGGCGCAGTAGACGAACAGGCCGTCGTCATGGGGGATGGCT
GCTTTCGAACTGTGTGAACACGTACAAGTCGAGGCAGACAATCTCCCTCTCACCCACCCGCCCAGCCCCCGATTTGAAGCTGTGAAGGTAGCAGCAGCAG
CAGCTTCGGATTGTTTTTACATTTTGACATGATCCTGGCAATACAAAATTCGATGTTTCCTTCGTGCCCTCATTAGAATTTTGTTCTGCTATATTTCCGT
CATTTTCATGAAGAAGTATGGTTTGGTGGCCTTGTGGAACTTCTTCGCCATGGCGGCCGCTGCGTACGTAGGTGCGTTAGTACGTGGTTGATGTGGGGCT
GGTCTCTGCTGCAGTTTTTGGAACAAAATATCTTGTTCTATCCGCCGTACATCTTTTTTTCTTGCAATGCTCTACTGTGGACGGCGCCGCAATACCAATT
CTCAAGATACGCCAACGATTGCAATCTTAACTGCGAGCGCGACACTTACTGCAGTCTCGTATTGCCTGCTCAACGCATGCTGCTGTCTAGAGTGACGATT
CCAAAATGAAGAATTTCTCCCGAGCCTTTTGCTTAGAAGCCCCAGATCGGGTGGCAAACCTTATTGCAATTATCATATGACAAAAGAAATGTATTATTGC
GGCGACGGTGCGTATTGCAATTCACGATGATAGCCGATTGCAGCATGAATAACGACTGCAGTAGGAACTGCAGTGTTGATTGTGTCTGCCAATCGCCGCC
AATTCATGTTTTTTTCAAACACTGCTCCGCTGTAGTGTTAGCAGTTATGGGGGGCGTGCTGTAAAGACGGTAGCATCTTTAGCTGGCATTTATCAGAATC
TGTGTATGGCTTCATAACCCCACTCAGCCCAGTCCGGAGGACAAATGGAAGGACCAAAAGTTAGGCGCCTCGCTCCGTATAACTAGAAATAAATAGGATC
ATGTGACTACATGGGCACAATCCCCCGTCCTAGCTGTCCTGGTGGTCTTATCGGTTTAGCGTCCTCCATTGTCCTTCTCGAGATATAAGCCGTTGAAAAC
TTGTCTCTTGTAACATCGGATTTTGCCGATTTGTCCAAGCCTAGGACAATTTTGACTTGATTTCAGTATGGTCTCAGCTGGAGCTATCTTTAGCGCCGAT
TTCCCTGCCCGATGCGCCTTATAAGACACACCTTTGGGGGGTCAAAAACACCCCATACAAATATCAAGTCATTTTGGTCCTTTTTCGGGCTCCCTAGGAC
AAAAACGGCCGGTGTGTGCCACACCAAAACACGATTTGGTCCTATCTCCTAGGACAAATCTAAGTGGGGCTAATATGGCGCTGTCATTTGTTCGGGGTTA
ATAAGATACCGGTGCGGTACACTGTACCACGATCCGAATCTCTTTGTTGCAATAGCAGCGGAGGGCGATGATCATCTTTTAGAGAGTCAACAAACAGAAT
TTCTACCGCAATATTAAAAAACAATGTTTTCATCCCCATATCCGCTCAAAGAACAAAACTCTACGCAAGCATGACGCTGGATGTGGCAGTGAAGGCGCCG
ATTCCTTCAGCCTCGGACGCGCCCCTGGACGCCGTCGCGCTCGTGCTGCTGCACCACGACGCCCACTACCGTCTGCTCGAGCGGTCTCTGCGCGATTTCC
AGCGCCTGGAGCGCCAATTGCAGCAAGAACCGCGTCCTAAGGCTTCCACCGCCCTCCCATCTATTATCCCCGCTATTGAAGCGTATTGCGACGTAAATCT
GAGCTTTTATCCTGCAGAACAGCAGGCGGCTCGGCTGGCAATAGCCCTGGAGGATTTTCTGCGTGAATTAGCTGCCGATTCGCAGCTTTTGGCGAGTGCT
CTCGCCCTTAAAACGTTCCTCCATGGGAATGTATTGTCAAGCCATACGACGGCCGGATCAAGCTACAGAGACGCAGTGGATGCTGCAATCGAAGCTGGTG
AAGAGAAGACGGACTTGATGCAGGAGCGGGTCGCTGCTGGCTGCTCGGTGGAGCACCAGGTGGCTGTGAACGCGACAGGAGATGGAGACAAGCAGCTTGT
GCTATGGAAGTTCTCGTCTCAAGGGACGGGATTGGTGTTCAGTGCTCAATTTTCTAGTGGGGACGGAGGTCACAGTGGGGACGTTGACCCGTACAGTGTT
GGTGGCAATGATTCTGCATCGGCTGATGGGGAAGAAGAGAGGGAGGTGGTGCACTACCGGACGAACTGTGACTTCGCTACTGGTGATGACGAGGAGTTCA
TATATGGCCACTTTGTGACTGAAAAGACGGGCGCGATGACGCTGCAATGGGAGAACGTGGACATGAGTAGTGTAGTGTCCAAGCCGCTGAAATTCCAGGT
GAAAGTGGTGTCGCTGAAAGCTGGTGCAAAGGTACTGGAGGTCGCAGACGGGCTGAACGCTGTTGACTCGAGCGAGTGGCTGTGCGACTACGTGTCTGCT
TCGGAGGTCACGGC