Description :
From Genome Similarity Track
Location :
scaffold_17:391666- 393463
Sequence
1797 bases(100 bases per row)
atgcgcacccactcggtATTTTacgtgagcttgctcaagccgtatcgggattcggcgcatgtgaacgcggaagcgtcgGCGCCAGAgaggatcccacggg
ccctcagttacccagaaactgaaccagcaaatgattctgagcacggaatgcaacaacctctatttccaatggagccaagcgctccaccgttgcctgcagc
gatgcattcgcctgctccacggctaggagtcgctccgacagagcgcggtattCCTCAagatgaggcagccggcgcacgaggtgctttaaatcgtccaGAG
CGTCTGCACAgagatatgctacttcagcatgatgctcagcggagctccgatcacgaaggatctcgtcctcaagggctcgaagagtatcacgagtcaccgg
acggcggccgacccggtcgtcaccgcccgccaccgactcttctcgatgagaacggtgaagTCCTTTATCACGTCGAACGTCTTGTTAGCCGacatcgtca
ccagggtcaaacccaatatctggcgAAGTGACGGGGATATACCGACTccgaacactcgtgaaagttTGAgacaccacttcggcaagtttgtccagtcgcc
gtggacgcttttgatcggaaagatcaggacgtcccgcgtcatcagacgccccgcgcttcccggcaatagccagaaaagtagaagggccatttgctaagct
caagcagtggccctgagctcttgcggtcgcagacacaaatCTCGCgagagcattaggggttaaaCCATACGtccagggcgacaatccgaaggaaattGAC
GGCGTGCCAtgcgtttggcaaactcaaatcgaaggtgtcgctccacacgcacggttacttccttgtggcttaactgtaggttatacagtgaggaaagctt
ccggtgccgttgcatccatcgctcaaagagcgtttcgccatctgtagcgctttcaccaggggcgagcactacaggtattgtccgcattgcgggtatacga
gagccacctcgttNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN