Description :
From Genome Similarity Track
Location :
Scaffold_47:391653- 395726
Transcript NameFunction/comments
Phypa_INRA-310PPTG_15408hypothetical protein
Phypa_INRA-310PPTG_15409hypothetical protein
Phypa_INRA-310PPTG_15410hypothetical protein

Sequence
4073 bases(100 bases per row)
CAGGTCCGCCAGCTCGGCTGATTGCTGCTGGTTGACGTACCCCAGGTCGTTGGCGGGGTCCGCGCTTTCGAGTTCCGAGAATACCCGCATATTGTCACGA
TGAAGAACCTGTTTCCACCGTTTATTGTCGAGACGTTCGTGGTCGTCATGCAGGTACCGCTCATAATTCTGGACTTGCTGTTGTACGAAGACGTGGACGA
GTTCCCTCAGGTAGTTGGCGTCGTGGTGGGCCAGATTGAGGGGGGCGAACGGACTCGCAGCATTGGCCATCGACGTTTGTCAAACCACTAAAAACTGGTC
GATCCGAGAAGTCTGTGTTCAAAGCTGGAGTGAAGCAAGTGGAGCTAGCAGGCGAGTTACCTCTCCCTTCTCTCCATGCGGGCGGGCGTGACACCTTTTT
CCAGCGAGATTGGTACCACATGGGCAAGTGAAGGCATCATCGTTTGAGCAGCAGATCCCGAGTCAGCCCAGGTGGTTCAGATGATAAGATCCTTACCCGA
AAGCAACTGGGCTTCAACGCCACTGCTCTGCCGATGGCATGCGTGCGCTGGTTTGTTCGGATCGAGCAGTTCGGTGCGTCCCGGGTGGATACAGTACTTC
ACCCCGTTTTCACGCCCTGAGACTTTTGATAAACTTCCGTATATAATTTTCTTTTTTTGCCAAATATCCTCGGGTTTAAATGCTGAAACCTGATGTGTTT
GCAAATCCTATATGGTCCATCCCCGCGAAAACGGGTGCATTACTGTACATATTTGCAAATCGCCTCTTAGTGGTTGACAACCCCCGGTTTTACAGATCAC
TTTCTGGGTCTCCAAATCTTGCTACAGTTTTATATGGCGAAAAGTAGCTGGCGTGAGTTGGCTACGCTTTATGACTTAAATGCAGTTCGGATGGAACACT
ACATGAACAGCAGTGCCTGTCGAGGTGCACAGTCAGACGGTGCCAATGATTCGAAATTAGCATCCGCTCCGACTTCCTCACAAGCGAAAACATGAGCGTC
GAGACGCCGAAGAACCTCATCCTGTGCTTGGTCTAACGTAGCAGCCACGAAATGAAGCACAGTGTTTCTTGAGCTCGCACGACGCGCATGCCGGACGCAT
ACAAAGTGCACACGTGTCGCTTCTGAGCAAGGACGTTCCCCCACCGCAATTGAAGCAGAGGTTTGCGCAAATGCCTCAGTAGAAGTTGAACTGCTGCTTC
TACTTGTTCTTGAAGTGGAGCGTGATCGACTCGCGGCTTCCCGTGCGAACAGCACTGCTGTTACAGCAGTGAAGACCGTCTGCAATGCAGACGCGCCGTA
CCATAACCATACCTGACGGCGACGGCGTGGCTACAGGATTCGTTGGTATTCACACAACGGTCGGTAAGCTTAGAACGCACATACTCGACAGCACTTGTAA
CCTGTGGCGGATACCCAATTGCTCGTGCAATGATCAAGTTTGCACGTGCAAGTGGGTATCCATCAGAGGTTGCATCACTATGACTACCAGCTCACTCACC
AAGAGCGACCTTCCCTAATCAGGAAATTAGGGTCGACCCGAGTAATCAAGCCACTTGAGTGTGTGTGGGTGGAACGAGCAATGGCCTCTCCAATGTGGCA
CTGGCGAACACGTCGTCTACGTACGAGGCCTTGAATCGCTCGGAATCGGTTGTCCAACTCAGTGGTCACTTGCACAATACAGTTGTTGTGAATACCAATG
CAGATAATCAAGTGTTCTTGTGCTTCAATCTGAATTCTGTTCCCAGTTCTCCGTTGACTTCCAGTGCAAGATGCTGCCTAACCATTGGAACCCAAGTGCT
ATGGTTTACTTTCAATACTTTTACATAACTGGCCAAATGCAACCGAAGTTGTATTTGTCGCGTTCACGACAATCTAATTGGCTTCTCAGTCGATTTGTTC
GCCGTACCGACCAATTTAAGGATAATACACTGCAGAATGTATCAGTATGAAATGAAAAATCAGTTGCACACAGAGTTTGCCTTTTCACCGACCTTTGCAA
CCTGACTACCATACAAAAAACATGTGCACGTTCCCTCGGGTTGCATAAGATCCTCTCATAACCAAAGACACGGCTCGAAACACAAGGGTAATGCGAGGCA
ACAGATACAAGTCAATTCTCAATGAGTTCATGGCGTTTCGAGCTGGTCATACCTTCAGTACGGACATTAGCTTCAGTCAAGACACCCTGTTGGAGATCAC
ACCCGACGACGTGTGTCACTGGATGAATTTTCGCGCGTTTGGAGACGCCAATCCTGCGGAGGACGCAAAACCGGTGAACGCCCGTGCGTCCACCTTGGAA
TACGCCAAGAAAGCGATTTCCTCTTTCATGCCACGCCGCACAGTTCCTTGGGACCCTATTCGCAACGAAGGGAATCCAACTCGCTCAGAGACTGTAAATG
CAGTAATTAAGAAGGTGAAGCGATGCGAGGTACGACGAGAAGGAGTCCAATCGGCAGCTAGGCGTCCGATCGAGTATGGTGAATTTCTTAATCTACTGGA
TCAAGTTCACACGGGAAACGGCAAGGGTTCACTGAAGTATTTAGTCTGTGCTGTGCTCACCATGCAATGGCACCTCATTGCACGCATTGACGACATGATG
AAACTGAAGTTCGATAGCTTTTCGTGCAGCATTCACCACCCAGGTTCATTGATTTGTCAATTGCGTTGGTCGAAAAATATCTCAGAGGAGCGGGACGCAC
CGGAACAAATTGTGTTAGGCAGCATGGATCCTCGGCTTTGCGCGCTGCTCAACTTGGCAATACATGTGGAGATGACGGATAAAGCAGCACTTTCACCGTT
TGTATTTGGTAATCCACAAGACGGAGATCGCGTCGTCCGTCGTTTTCTGCAAGACGTTTTTGAAGGAACCGACTTTCACAAACTCAAAGCAGGCAATTTG
GGTACACACAGCATGAGAAAAGGTAACAAATGACCTGCTAGTCAAACATGTAGGTCCTGCGCTTAAGGAGGCCCTAGGTGAAGAGCTGGCTCGGGTGCTC
GCGTTGCCGCTCCTTTGGGCAGCATTAGTGCCGCGTGGAAGTTTTGACTATGAAATCATTCCAGCTGCTCTTAAGCGGCGCATTATTCAAGCCTATTTGG
GTGTTGGTGGGAAAGAAGACGTCAATGTTGTGGAACGTGTACCCATTCACGTTGTTGGTGATGGTGCTCAGCTTCAACTCGTCGAAGTACATGATAATGC
TGGTGAAAATGGCGTTTTGGATCGCCAAAATGGCGGCTTGACTGCTGACAGCACTCGCAAGGAATTCGCTTCGATTCACTCTCAATTATTCAGTTTACAG
CGACAAACGGCAAATTTGCTGAACGAAATTCATCGCTCTCGCACAGAGAGACAGCGGGAAAATCAAAAGATTCTGGCAGTGATTCGACGTATAGCCCTGC
AACCTGTAGTTCGCACGATACACCCTCACTCTCAGCAAATGGAGGTGGAGACGGAGTAGAAGAAGAAGGTTCCGTCGTACTTCCGCGTGCAATGCTCTCA
AAACGACCGAAGGATCTCTACGAACTATGGGGAGAGTATGAGTTCGGATTGAACGGATTGAAACCGGCAAAAGAGTTCACAGCAGCTGAGCGTGGCGCCA
ACAAATTCGCGTATACTCGCCGCAAGGTATTCTGGGACGTCGTCAGTGCATTTGTTCGCACAGGCTTCACCAGCGACGTCGCCATTGATAAAATCTACGC
TGCTTACGGCCGGCAGCTATCCGTGACTCGAATTCTTACTGCACTCCGCACTGACAAGCACCAAGGTGGTCATCCCTCGCTGCGTTTGTAATTTCTGCCA
ATAAAATTCAGGAATCTAAAGTTTCACCAATCAGATTCCGGTTGCTCTCTCCGTTGCATACTCAGCCAATATTTATACAGTACTGTACTCCTTATAATCG
CGGCAATGCCGACTAGGTCTCACGTATCCATCTCAGTCTCGGTGGGATGTGGTACTCGACCGTCGGATAGTTATTCGCTATGAGTCAAAACCTATGACTA
AAGATTTCTTACTTAAGTATCAGTAAGGAATCACACGTAAATCAACATTGAGGACTGCATTTTTAATTTTGCA