Description :
From Genome Similarity Track
Location :
contig_166:3915- 9692
Transcript NameFunction/comments
g11867.t1PREDICTED: uncharacterized protein LOC101063318, partial

Sequence
5777 bases(100 bases per row)
GTTGGGATCGGAGTATGTGTGGCATTTGAAAGCTGCCGGCTTCCGGAAGGTGCGAAGTCCACGAGGGGTTGCGGATGAGGAAGCTGCGTCTAAACGTATT
CAACGTGTGGCTGCCCGACCGCCTCCTTCCTCGATCCCATCACCGTCATCGCTCCCGTCGGTGCCATCTTCGGTTGTCCAGAACCTGGAAGTGTTGTCCT
CTAGAGGCAGTCTATCCTCCGCCCAGAATGTATCCGAACGAATCGGGTCGGATTCTACGCTGAGTATGTTTGGAACTTCCGGAGGATCAAGCGAGTCGAT
GGCCAGTGCTACATCCAGTTCACGGACTTCCAGAGATAGTTCGTCCGGATCTTCCGGATGGAGTGTTTGCCAAGGTGCAGGAGTGCATATGCCGTTCTCA
GCGTTTGAACCACGGGCAATGACAGCTCAGAGTCTGGGAGGAGCCGTCCGGCGGAGACTGGTGTAGGCATGTACGTCACTCACGAAGTGATTCCACGGAA
CCCAGTACCAGTGATTCAGGAAGACATCGTCATGTCAGAGAGACGAAGCAAAGGGTTCTCGAAGACAGAAGCCCAAGGTTTCTTCCCGAAGGATCTCCCG
ATACCGGTCGTACAGCCGCTCGTTCATACCGCAGTAGTGCTTCCGGAAATGCTGCTGAGACGACACATCAGAAGCCGGATGTGAGAGGCTCTGATGAGAT
CGTCGCGGCACAATTGCAAGCTACTTTGCAGGCATTTGCTGCTGACAGAGTTTCGAAGAACCTGATGGGAAAAACCGTGAAGATTTCTGAGCCTATTGTG
AACGTGAAAGCGGAACCCGTTTCTGAAAGTAGAACTTTTGCAATGGGAAAGGCCGAGTTGTCCTCTGGAACCAAGTCAACTGCACCTGGAAAGTCGTCAA
ACGGCACATGTCCGAAAAATCTGGTTCGTCCAAGAAAAGTTCGACTTCCGGAAAGGGAAGAGGACGAAGAAGTCATCTGGAAAGTCAAGTGATCCTTCGG
ATTCTCCAAGTTCTGAGTGACTCGTACTCGGACAGTTCAAATAGCAGCTCTTTCGAAGATGTCGTTCCGAATGTCCATACGACACCGGGTCCAGGCGGAT
CTCTGTTACGTTCAGACCGTACGTGAATGCCAGCACGTTGGAAGACTTCAATGAGAAGCGTCACTAGCTACCCGTATCCGGTGGTTGGAACGATTCCAGA
GTTTTGCGTTCAAGGCGGTTGGTCGGATAAGGTCAAGATCTATGAGATGAAGCTGAAGTTACCTGCTGCCGTTCGGAACTGGCGTTCGAACTTGAATCCC
AACGTGCGCCGGAAATGGAAGAAGTTCCTGAAGGAGTTCCGAGATATGTATTGCAAGGCCAAGACCTCGGATTCAGAACGTTATTACACGATGATCCAAA
AGAAGGCAGAAACTCCGCTGGAATTTTACTACCGCCTGAACAAGGTGGCCGACAAAGCGGGATCGAGTTCGACGCATCGAGTAAGCAACGTGAGCGCCAT
CTGAAAGTGTTCACGAAGAAGCTTCTGGACTCTCGCCTCCGAACGACTTTGCAAGGACAACGTCTGCGTCGTCTGAAGGACCTGGATATGTCCTGAAACA
GCATGAAGAAATGAATCAAGACGACGACTACGATACTCCACCTCCGAAGAGAGACTTCCGAGCGGACAATGTCCCTCGTGATCGATTCAGACCGAAACGT
TCTGGAAGGCCTATGTCCTTCACGATGACGATAACCGGGATGGCGCACGACAGACAAGTCCATTTTTTGGAAGATGTGGAAGAAGTGACAAGTCGAGAAC
ATGTTCCTAGTGTGCTGACTACTCCAACTGCGGATGCCACGAACGTGTCCGGTTCGAGCATGGATAACCTTTCCGAAGCAGTATTTCGTGCGATGGAGAA
TCCTGGATGGCGGCCACCGACTTCTGATTTCCGTTCGGATCGCCGGCGGCAAACGTTTGGAAGTCCGAACGCGTCCAAGTTCTGTGACAAGTGCAAGGAG
TTTGGACATCTGACGGAGAATTGTTGGTCGGACATCGAATGGACATCCGACGCACCTCTGCAGGACTCGTCCGTGTGCGATTTGTAACCAGTTTCACGAA
GGCAAGTGTGAAGAATGGAAGGCTTTCAAGCGATCAAGAATCTTGCACGTCAAGGAGCACTGAAAGATCTGCCGTCTCCTATCCGGAAGCAACTTCTGGA
AGGGAAAGTGGATCCAGGGGAACAGCCGTTAAACTAGTAAGCCCGCTGGATGGGGATCCAGAACGCGACGGGCTGAAGAAACCCCCGATATGTGTCTTCT
AGTGTATGTTGGTCCGGAGTTGAGACGCCAAAAACAGGATAAACATCAATGCATGACCGTGACTCCGGAAAGTGGTGACCCTCTTTCAGATGAACTTCGT
CCTGAACGAGTTCTGTCGGAAGGTGTACGGCCGGAATACAAGATCCGGATGTACCTGTTGAATTCCGACTGGGACCAGGCGAACGATATGGCTGGTGGGA
AGATCACTGTTCGGATGACACGAAACGGATTGCGATGGTTCACGGAGCGGTGAACAATTGTCGGACAGACATCCTTTTGGATTCTGGAGCGTCAGTAAGC
ATGGTGAGTTTGGATCTTGCGCGTAGACTCAAACTCAAGTTAAGCTTCTGCAAACAGCTCCGGGTATCTGGACGGTGGCGTTCCGACCATCATCACCGCG
AGTGCTGAAGTGAAAATCACTTTGGGTCCGAGAATTGTGTATGTCTTGGAACTTGGGTCGCGAACATTGGTGAAGGTGTCGACGTGTTGCTTGGAATGAA
TTTCATGTATTCCGCTGGAGTGCGACTGTGCGCACGAGAAGGATTGGTGCAACTTCCGGATGAAGAAACTGTGTTGCTATCAGGACGTGGTGCGGATCAT
TACCACAGAGGTTTGGACCTTCCGGTGAGACCGCGTGAAGAGCTTTTCCTGCGTCCAGGTGAACATGCTATCGTCCGGATACATTACGGACAGAGCAATC
CACAACGTGATGTGGTATGGGCTGGTCGGGGAGACCGATGGGTAACCCAGATCATCTATGCTGCTAGATCGTGGGCTGTGGCCATCAAAGTGGTGAATTT
CCGGAAGGTGTCTTAGCATTGACACTCGGACGCCGGTTGCTCGGATCATCGAGTTTGGCTTCTTCCCGAGGGCAGGACGTTTTGTCCGCCCGGGTCTCCG
AAGGTATCAGGAGTGGCAGACTCTCATCTATGAGAATACCGAATCCAATCAGATGCGTTTACGTTCTGAACGATTTGAGCAGATGATGAGGGACGCCGAA
CCTTGCGTCCAGAAGTCCGAATACTCACGGCTAAGCTATTGGTTCGACCGCTTCCTGGAAGCGACCAAGTTCACATGGTGCAACTTCAGGAGCTGCCTCG
TGTCTTACGTCCGAAAGTGGAGGAGACTCTTCCAGATGAAGTCATCGCAGAAGACACGGTAAAGCTGAAAAAGGACCCTGAGGTTGAGGAAGTGCCACGT
CCGGAAGATACTGGCGACGGATGTCATCCAAGGGAGTCGGAGTCATACCAAGGGTTGAAGAACGTTTGGAAGCGCAGAACTTCTGACGGACGACGTGGAT
TCGGACGGAGATGAATTCTTTGATTCGATTAGTCTGAATGAAGAGTTTCCGGATGAAGGTGCTGACGATGTGAACGATTGTCTGAGTGACTTGTCAGGAT
TGGACGAACTCCGGGATCAGCAAACCCAAGCCATGCTCTCTACCCCAATCCAAAAGTTGAAGTCGAGTATGAGAGGTGCATGCGTCTGAACGCAGAAGAG
CTGGATTTGGAACCCGCTGTGTACATCCATGAAGGAAGTGACTTGTTAGCCCAATTGCGTGATCAGCTGGCGATGCTTCCGGAACTCCAAGAGTTGAGCC
CGACATGTGATATTGATGCGGCTGATGTGGGAGATTCGGAAACGACATCACCTCTGGAAGAGCAGAAGCTTCGGTCCATCCTGAAGTACCACCGCTCTAT
TTTTCTGGGTGATGGAAATGCCGCTCCTGCTCCGGCAAGAGGAGTGATTTGTGATTTGGACGTTGGGACGGCCAAGCCGGTCGCACAACGCGCCCGATCC
ATCGCACCTCATTTGGCTATCAAGGTCTATGAGTTACTCAAGAAACTCTTGGAAACTGGATTGATCGAACCTTCCGAATCACCATGGTCCTCTCCGATCG
TGATTGTCCTGAAGAAAAACGGTGGACATCCGGATGTGTATTGATTACCGGATCGTCAATGGTTTTATCGAACTTTCGAACTACCCGTTACCACTGATTG
ACGCTTACTGATCGGATTTGAGAACGCAATGTGGTTCATGAGCTTGGATATGGCTAGTGGATTCTGGGCGGTTCGGATGTCAGAGCGTGCCAAGTTGATT
TCGGCTTTTGTGTGTACTTCCAATGGGTGCGAATGCCGTTTGGACTCAAAAACGCGCCTTTGGTGTATCAGGCAGTAATTAACAACTTCGTCCGGCTGCC
TCCAGAGGAAGAAGCTGAAGTCGACCAAGACGTCTTGGATTTCCTGAAGTTGCCCCCTCCGGCAGCCAATCTTCTGGATGGATACCTAATCCGAAGTCCC
GACGCTGACTGAGTACATGACTGTGTTCAAGGAATATCCCTGCTCCATCTCAGATGGGCCCGTCTTGGGACGCGTTCCTATATCGACGACATTGCACATG
GAGCTGAAACCTGGGACCAACTTTGTGATGATCTGAACGCACTCCTTTTCAGGTTGAGGTACTGGAATATTTCCGTGAGCCTCCCTAAAAGTGAGTTCGG
AAAGAAGTCGTCCCGTATCTGTCGCATGAGATCAGTGCTGAAGGCATCCGAGGGTGAAAGGCGTTCAGGACTTGCCGTTCCCAAGCACACTGAAAGGGGT
ACAATCGTTCCTCGGAAGTCTCAATTACTATCACAAGTTTATTGAGGACTTTCCAGTGGTAGCTGCGGTTCTGTATGAACTCTCGGATGACCAAGTGCGC
TCAGGACGTAATCTATCAAGAGCTAAGGAGGCCTTTGGAATCCTGAAGCGGAAGATTGTCTCGACTCCGTTGCTACGCCATCCGGATCGCTCCCGACCGT
TGTCATCATCCCGCATGCCAATCGTGGGCTGCATGCGCAGTCCTCGGGCAGGAATATGATGGGAGATACATCCAGTCAGGTATACCGGCCGCGTCCTGAA
CGACTCCGAAGTGAGGTATCATGTCGCCGAGAAGAGGTGATCGCTATCATGAGGGTGCTTCAGGTGTTCCGGACGATCGTTGAACATTGTCCACTGATCA
TCTACACAATACTCCGTTCTGAAGTGGGTCATCACTTCCAAATCCGACGGAAGATGCGTCCCATGGGGACTTGCGTTATCCGGGGGAACATGGAAATCCG
GAAGTTCAACGGGACGAGGACGGTCTGGCTGCTATCATGGGCGCTGGGATCACTCCGCGTGAACACTTAGACAAAGTTGCTGAATCATGATTCCAGCGAA
AGGGGAGATCCGGCACCGCCTGTGGTGAGTGTTGAGATGTTGGATGCAGATTACGATGGATCGTCCTTAGTTTCGATGGAGCTGCCAAGACGTCGACTCG
TCAAGGAAGCTGCGGGTGCATTGCCCGGTTGGACCGTTCTAGAAGCACGGTTATATTCTGAAAGATGTTACTGTGAATGACGCTGAGTACTATGGACTTC
TGAAAGGTATGCGATGGCTTCCGAACGTCATGTCGAAGATCTATTCGTGGTCGGTGACTCCCGGATTGTTATTCAGC