Description :
From Genome Similarity Track
Location :
Scaffold_1192:3915- 6666
Sequence
2751 bases(100 bases per row)
CGCGGCTGCGGACAAGCGCGCAAGCAGGCGCCGCAGTCCGTCGGCCTCGTCGTTCAGACAATCGTCCGAACCCTCGGTTCGTAGAACGTGAGTTCAACTC
GGGCAGTGAGGACGATGCCGAGTCCGAGAGCACTCATGATGCTCCTGCGGGCTCTGTGGGAGGGCACAGCCCAGTGCCCAGTGAGCACAAAGAAGACAGC
GTGCAGTCGTCCGCTAGTGATCACGGTGATCACAGTCCCAGGACCTCTGTGCGCTCTGAGAGTCCGGCCGTTAAGGCTAAGGGCACTCCCAAAGCCGGTG
GCGATGAGGAAGGGAGTCCTCGCAAACGTCTCTCGCTTGCCGAGGGTCTTGCGCGCGCTAAGGCCTCTAAAGCCGAAGGCCAAGCCCTCAAAGAAGCGTA
CCGCCTCTAAGTCTCCACTCCGCGAGGAGAAGGAGACTCGACGCTCCTATCAGAGTCTCTTCGGCTCCTCGGATGAAGAGGAGGAGAAGGAGAAAGAAGA
GGAAGAGGAGGGTGCCATTGTTGAGCCCCGGGAGGTCTCGAATGACCTCGACCAGCAGCAGGAGGATTTCCAAGCTGCCCAGCGTGTGCGTGGGGGTTCG
GTGGCGGCACCCGTCAGCCAGGGAGCTGCCATCAACTCAAGAGGGTATTGGCCTCCCGAGGAGAGCTCTGGGGCTGACCTCTTCTTAGAGCTTCTCGTCG
CTCCTCGTGGCCTTGTGGGCGGCCACACTTCTAGGGGCATCTATGAACGAGCCCTTGTTCAGAAAGAACAGTTGTTCGTCGACAACGTGGAGGCTGCTCG
GTGTGTGCTTCTCGCGCCACACCGCATTCCCCTTAAGGACTTCACGACTTGTCGTAAGAAGCCCGAGACCCGGGGTGGTCTCTATCCTGTTTGGGGATAC
CCCTGGGTTATGCCCGAGAACTGTCCCACATGGAGTTCTTGTGAGGACATGTTCTGGGCGTGGGTGGAGACTCTCAAGTACTCGCCCACGGAGTTATGGG
AACTCCATGAAGATCAGCAGCTGTCCCACATCCTGGACCAGCGTGATCTTCGTGTGAGGTTTGCCCACTTGATCAGCAAGCGTATGCTGCCAAGGGACAT
CCTGAAGCGCGCGGCTTCTAGCGCTCACGATGAGCGCGGGTACGGTATGTATTCATCATCCGTACCCCGTTCGGGCAAGAAGCCCCGGACTACTTATGAA
GCTGCCGCCGCTTCTGTTCCCAGATTGCGACAGCCTTCGGGCAGTCAATCAGGAGCCGTTCAATCGGCTCCCACGAGTTCTCGGAGTGGGCATAACCCCT
CCACTTCACGAGGAGCTGTCGCTTCCCGCGACACCGTTGCTCCTGGAGGATCCGCTCCACGTGGAAGTGGACTTCTCCATTCCGGTCAAGCAGGGGCGGA
GGTGCCCTCGTACGAGTACGAGTACTCAGCGCCTCCCGAGAGCCACTCTCGTTCGAGTGCTCCGACTGCGGGTCCGACACGGGACCCTGAGGTTGACCGC
CTCCGTCAACGTCTCCTCGTGCTTGAGATTGCACTTGGCCTTGGGACTGGCGGTAATGCTGCCGCCCAGGCCGGGAATCAGGGCGAGCTCGCTCGTCTTG
CGGGTCGCCTGGACCTGGTGGAGCGAGAGGTCGCGAGCCTGCACCTGCGGGTGGATCGCCGGGCCTCTTCGTCCGATCTGGACGAGGCCTTTCGCATGAT
CCGACGGATCGAGGCTTTGTTGCCACGTCCGGATCCGCCTGCGGCACACTACCAGACGTACGCGTATGGTGCGTACCCGGCGTACTCAGCGTACTCGGCG
TATGGCGCCGGGGTCCGTTCGTATGGAGCCCCTCCGGCGTACGGTCTTGACCGCAGCCTTGCCGTCCCGACCGAGACTTGGGTGCCTGCTCCGACGCCCT
CGTCGACGACTGTGACCGGCCCTCGCTTCGAGGAGCTGGGTCAAGGGGGATCTGCGAGTCAGCAACCCCCTGCGGGTCAAAGTACCGCTTAAGACGTCCG
ACATAGAACGTCGTATGCGTCGTCATTGACTTTGGAAGGTCGATGGTGTACGACGCACCATGTCTGGCCAGGACTGCAAAAGGTCCGATGAAGCGGTGCT
TCAGTTTGTTGCTGCCGACAGAGCTAACAGTGTCTAGAGGTAGGTTCCTCGTGTCTAGCAACACTAAGTCACCAACCTCAAATATACTTAAGTTTCCTCT
TCCTTGTTTGTCTGAGTACTCCTTTTGTTTATCTTGGGCCGCTGCCATGGCATCGCGGACCCTGCTGACAATGTTCAGCTTGGTATCCATAAAGGATTTC
ACCTGTTTCCGCAGCGAAACTGGCCTCACATCCGAGACCTGGGAGGAAAGGGCTTTCCGAGCCTCTCCCCCACTTAGAATAGAGGAGTCAGTGTCTCCTC
GAAGAGTGAGAGGCACTCTGGGGTGGCGGAAGCCGTTCAAGTAGAACGGCGTGAACCCCGTGGACGCGTGCACCGCGTTGTTGAGCGCAAACTCAACAAC
TGGAAGCTGCGACGACCACGTACGTGGCGCTGCCGCGCACACACTGCGCAGAGTGTCCTTGAGCACTCGATTGACGCGCTCTGTTTGGCCGTCTGTCTGC
GGATGATCCGCAGTGGACATCTGCAGACGAGTTCCCAGTAAAGGGAACAGCGTTTTCCAAAACGCAGCAGTGAACCGCGGGTCTCGGTCCGAGACAATCG
TCTCCGGGAGACCGTGATAGCGAAACACGCCATCGACGAACAACCTTGCGG