Description :
From Genome Similarity Track
Location :
scaffold_74:39141- 41547
Transcript NameFunction/comments
g2818.t1hypothetical protein
g2819.t1 hypothetical protein PHYSODRAFT_327098
g2820.t1 hypothetical protein PHYSODRAFT_481082

Sequence
2406 bases(100 bases per row)
ACGTGTCCAGACTTCGATGTGTGCGACGCCTGTTATGCGAAGGAGAAGCATGAACACCCACTGGAGATGGTGCCGACTAGCGGTGGAGGCGTTGCCGGGG
CTGGTGCAGGTCCTGCAGGGCCTGGAGGCGCGGCAGGTACGGCCGCACTGTCGGCCGAGCAGCGGCGTCTTCGCGAACAGCGGGCCAAGAACGTTCGGTT
GCACATGCAGTTGCTGGTTCACTCGAGCTCGTGTGCTGACGGCAACTGCGGTTCGTCGAACTGTGAGAAGATGAAGGAGCTAATGCGCCACGGAGCGCAG
TGCAAGCAGCGTGCGTACGGTGGCTGTACGATCTGTCGGCGCGTGTGGGCGCTTCTGCAGCTCCACGCCCGACAGTGCCGCCAATACGAGTGCAAGGTGC
CGCGCTGCCACGACCTGCGCGAGCACGTCCGCAAGTTGCAGCTGCAGCAGCAGCTCATGGACGACCGTCGTCGTGCTGCCGTGACCCAGCAGTACCGTCA
AATGCAGAGCGAGCGCCAGCAGGAGCAGCAGAACCAAGCTCAAGGCGACGACCCCATGCCTCAGGCATGACCGACAGCACTAGATCGAGCGGTTGAGGAA
CCAAAATGTCGAGTGTAGCATAGGATAGGGTAAACCATACTAATTGTAGATGTGTGTCAACGTGGCTGAAGTCTGCAAAAACAAATGAACGACGTGGATC
AAGCCCGCGCATACTATAAACTGCTCAAGAGGGGGAGTCTTTCTAACGTGAGATACAGACAGCGGCAGGTCGATCGCGGCTCCTTCTCTCTATGCCTTCT
TGGCTCCGAGCCGTTTCTGACGGCGACGGTGGTGCGAGCACGGACGCTTGCCGTGGTTGGCCTGTAACCATATAACAAACATGAGTACAGCAAATTCCAA
CAATGAATTTGTATCTATCTCGACCTTCTTCGGACGACGAGCGTTGCGGTTCAGCAGCTCCATGGCAATAGGCGTCTCGAACAAGTTGGTCGACGGCACG
CTGCGCACGTTAGCGACGGCCAGGGCGGACGGACGCGCTGCAAGGAGGAATGACACACAGCGATTCGGACATAGTGAGCATAACAGACAGCGCAGAGACA
AGAGCATTTGAGAGACCAAAGGCCAAGACTAACCGGCAATGGAAGGCAGCAACGAGGCCGGCGCCAACGCACTCTTGGTCACGGCGGAGAGCAAGCGCGA
GCACAGCATGTCTGGCTGGGGATGCTGGTTGGCTTTGGTAAGGAAAAGCAGAGGCTACAAAACGGGGTAGACTAAAGTTGCGCGAAGGAAAAGTTGCGCG
TATGTTGTGCAACAATGAATAAATTACGGTAATTTACGTAAGTTGAAGTGTTGCCGCATAATGGAGCCTGCAGTCGCGCGCAGGGAGACGTACCAGCGGA
AAGAGGGCACTACGCGGCACCAGCGGGCTAAGGCAGGACGTCCTGATGCAAATGCTACTACTCCTGGAGAGTTTGTGCGGCTGGCAGCGGCTATCGACGG
CTGTGCAGCTTTTAATCCGAAGCAATGGCGGCATGTGCTAGACAAGTCGGCGACTGTGCTGCGTCACAGCCACAGCAACGGCTCTCGATCCTCCAGCAGC
TTAACTATAGGTGACAAGAAGAAAATGGGGAGAGAAGGCAAGAGAACAGCAGTGCTACGTCCTTTGTCAAGAGAAGAAGACACTTTCGCTCCAGTGGAAA
GGGACGGGATCTTCCCTCTTGTCTCGGTGACGCAGTATTTGAACCAGCCAGATATGGTGCAGGATATTTTAATGCAAGCAGCAGCCGAGGAGCAGCAGAA
GCAGGAAGTTGAGGTGGTAACAGAGAAGGATGAGGTCGTTGTAGAGCGAGAGCTGCAGATTGAAGAGAACGAGGATGATTTCCATGACGTGGAGGTGGAA
CAAGACGACCAAGAGCCGATTCAGGCTATGCCTATTGCGCAGACAGAAGCTTCGCATGTGATGCTGCCTTTGCTGATGACCATGTCGCCCCGGACGAGAT
GTGAACTGGCGCATCTTCCGCCTCCAAGTGATGCAGAGATGCGTGAGGTTGAGAGCTTTGCGCGCTCAGTGGATCATCCGGAGTTTTCTGAAGACTTTTA
TCGCGAGCTGAAGAGGGCAAGAATGCGTAATGTTTTTCAACCTGCAGTGACAGCACTTTCGACTGATAAACTAAACTGGCAGACACCGCCTAAACATGCT
TCTCCCACGGTATCACTTCGAAGAAATAAGAGACCACGCGGTGCTATCAAACCGCTAAATGCACGGACGGAGCATGAGGAACACGTGTCTAAGTTATCTT
CGACATCAGTGGAGGAGAAGAACCCCGTGCCCGATGTGAAAACGCAGGTGAACTTGAAGGGAGAAAACTTCTTGGCTAAAACAGTTTTGAAGACATCGCA
TCAACG