Description :
From Genome Similarity Track
Location :
Scaffold_1:3914080- 3921972
Transcript NameFunction/comments
Physo_323035Hypothetical protein

Sequence
7892 bases(100 bases per row)
ACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAAAGCAGCATCTTT
TAGCCGATGAGCGACATGCATAGCATTGGAATTCTGCCAACCGGCCGTTGGCAGATTCCTAACTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAA
ACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGTCCGAGTATAATTAACTCTAGTTTA
AACTAAGCTACGCTTCCTCATACACGTGCGCATACGTATAAGCCGTGGTAGTGAGCCAAGGTAGGCCCATTACACCTGGTAGCACTTTGTAGTCCGTCCA
ACGACCGACTACCTGAGTTCGTACGAACGTGGAGCTGAGAACCTTCCCATGGATACAGAGGTGTCCATGGAAAGCTCCACTACGCCTGCAACTCACGTTG
CACGCGCTGACTGTCCCCATCTGTCGGATCCAGAGTGGGAGGCCCTCCAACGACTGTCAACAGTCATTGGTGAGGCGGCTGTAGCTACGATGCTGCGTAC
GCTAACGCCGACAAAGCAACACGGTTTTGCTCTGGGTTTCATCCTGAAGGAGCAACGCGATGTTGCTGCTACTACCGCGGTGCCGTCCGGGACGACACCA
CGCGCGCAATCGCTGAAGCTCAATGTGAACAACTATGTCGTAAGAGAGGGTGAACCTCTCCTCCGTTGGCTTGTCGAACTCGACACTGCCATTGCGGCTC
AACGTATCGCCGACCCGTTGTCGAAGGTTGCGTTCGCCATGCCATGTCTTGGCGGACGTGCAAGAAGTTGGGTGTATGGACGCCGACTCTCGGATCCTAC
GTGCTTTAGCACGTACGAGGGTTTCAAGGAGGAACTCAGACAAGCGTTTGAGCCCCCGCAAAACGAGTTCCGGTCGAGGGCGGAGTTCCTCGACCTGCAG
CAGGGCAAGTATGATGTCCATGCTTACGCTCAGAGAGCACGGTACTTGGTCTCGAACATCGTGACCAATCCGATCGATGAGGCGACCAAGGTCGTCACGT
TCATGAAGGGACTGAGAGATGGGCCTGTGAAGACCTATCTCTTCCGTGAGTACCCGAGTACTCTCGAAGCTGCAATTACTCTTGCAATGCAGGAGGAGTT
TAGCTTGCGGCAGGCTAAGCTGCATGCACATGTGCCGAGGCCACAGCCACGCCCGGTAGTGAGGACGGGAGGCCCAGAACCCATGGACCTCTCGAGTGCT
GCAACTACTGGACCCGACCCCAGCAGTCGCAGGGAAACAATGTGCGATGTTACCGTTGCGGTAGAGTCGGTCACTTTGCTCGGGAGTGCACGGCCCCCGT
GCACCAACAGGGTGGCTATCGTGGCGGTGCCGGGCACCGTCGCAACCAAACAAAAAACGCTGGACGCCAGTAGGCGCGGGGCGCCCTACTGGTAATGCAG
TTCCGCGTGTCGACCTTGGACACGCGACACTGAGGACTGCAGCCCCCAGTGAGGTTCATTCTCACTGCAAGAACCAAGATGACAAGCCTGACCTTTTCAC
CCTGAACGTGAACTCGATGAGAGCAAGCGGCTCTCTCCGTGCTTTGGTAGATTCTGGGGCGTCGAAGAACTTGGTTCGACTGCGAAGTCTATCAAGGCTT
GACTTCGAGGATTTTAAGATACCTCGAAGTATGTTGGAGGTACGACTGGCAACGGTGCCGTCGTGAAGACCGAGAAGCGCATGGTACGCGTGCGCTTCAC
GTATGAAGATCAAGAGTTTGTCGAGACCTTTATCGTCCTGGATCTGGACGATAAGTTTGACATTGTATTGGGTATGCCGTGGCTTGCACGGCATGATCCG
GTCATCGATTGGGAGAAGAGCACTCTCGTGCGCTTCGGTCGCGACAGCGGAACAGTGAGCGATGGCCCTGTTGTCACTACGCACGCACCGACAAGTGCGC
GCGACTCCCCACTCGAGACAGCGCCTTATCCCACTGTCCCGGAGCGCCCTGGACGCGCGCGAGCACACGCGCAAGAACAGCTAGCGTCGGCGTTGCCGCC
GACAGCTAATGAAGGAAATTTGTTGACCTCGGAGGCCGACACACGCTTTCAGCGAATCAGGAAGAGTCTCCCGCCCCGAAGGGCGGTGATGACGCAGGCA
AGTCACACGCCTCAGCCGTGGAGGCTGACTCGAATCAGATTGGATCAGGTCTGGCCAATAACAAGAGCCAAGGTGACGTAACGCCGTCGACTCCGGGAGT
CGATGGCTTGGGTGAATTTGATTTGTCTGCTCCGGGAGCCGACGCACCCTCTGTAATGGGGGACTCCGCCAATGGTTGGTGTCGAGGTATTGAAGTCGCA
TCGACTCCAGGAGTCGATAGCTTGGACGAGTTTGATTCGTCGGCTCGGGGAGCCGACGCACCCTCCGTAGTGGAGGGCTCCGCCAATAGCAGGCGTCGAG
GTAAGGATGGCGTGTCGGCTCCGGGAGCCGACGCTGCAGGCGGTGCGGACGGTTGCAAACGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGG
GCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTGAAGTCGGTCGCCCGCGGGATGAACCCGCCGGCGGTACTGAAGAAGAACACCCGTCCACGGCT
GGACCTGGACGAGGTCAAGAACTAAGCGGAGCCGGGCTCCGCAAAACAAGAAGACGGCGCATGCGAAGGTCGCTGCGCAAGTCTCGGCCTGGGGCCGAGA
CGCTACAAGGAATGTCTGCCGGGCAGACGGAGGCTGAGAAGCCGGACGTCGAGACGTTGAACGTCTTGACCCGTACCTGTGCCGGGTTCCGGTACAGGGA
GATGACTCTCGCTAACCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGTCATGAGCTGGAAGCGCCTCGCGCGTGACTTGCGCGATGGACGCATC
GAGCAAATATGCATTCTCTCGGACGCCGAGAGAACGAAGAGCGAGAATGAAGAACTGAGGCACTTCTTCATGGAGACCACCACTGGGAGCGAGGACACTC
TCTGTGAGTCCCTACTACGAGATCTTACGGGAGTACGCGGACGTACTTCCGGAAGAGATTCCTGCGGAGCTTCCGCAGGACAAGGGAATCCAGCACGAGA
TTGATCTTGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCTAGAGCAGGTCAAAGCGATCGACGACTTCTTCGAAAGTCGTCGCAA
AGCTGGACAAGTGCGGGAATCGAAATCCCCCCACAGTGCTCCGACGTTCTGTGTCAAGACGCCACAGGGCGGCTGGCGCATCGTTCATGCGTATAACAAG
CTGAACGATGCGACGATACCGGCGCAGACGCCGATACCTCCAAAAGATGTTGTCATCGATTCGATGGTCAGGGGCACTATCTACAGTGCTCTTGATCTGC
GCGATGGGTTCTATCAGATCCTCATGCGTGAGAGCGATATCCCTCTCATGGCTGTGAGCACGCCGAGCGGCATGCTCTGGGAGTGGCTAGTGATGCCGCA
GGGTCCGAAGACCGCCCCTGCGACCTTCAACAGGTGCGTGACGCACTTGTTGCGCTAGGTGCGCGACTTCGCACCGAGCTACTTCGACGATGTGTTCGTC
CACAGCCGGGCTGCGGACGGGATGAGCGATGTTGAGATGCACAAGGTTTATCTCCGGAAGCTGCTTGCGCTCATGCGCAAGCACAAGCTCTATGCGAACC
TGAAGAAGTGTATCTTCGGGGCGAGCGAGATACTCGTGCTCGGGTGTCTCGTTGGGAAGAACGGTGTCCGCCCTGACCCTGAGAAGGTCAGAGTGATCAA
TGAGTGGCCGACGCCGTCGAACGTCAAGGAACTGCGGCAGTTCCTTGGCTTGGCCACGTACTTGTGCAAGTACGTGAAGGACTACGCGGGCATGATACGC
CCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGACTGCTGAGTGTCAGCAGGCCTTCGATGCAGTCAAGCAGGGCTTGACTGGGGCGCCGA
TCTTGGCGGTGGCCGACCAAGATCTCCCGTTCCACATTGTGTGCGATGCTTCCGACTTCGCAATCGGATGCGTGTTGATGCAGCACGATCACGAGGGCCG
TGATCGTGTCGTCTATTACCAATCGCGTCAGCTGAAGCCAGCTGAGCGACACTACCCGGGACATGACAAGGAGCTCCTTGCCATGAAGTACGCACTCGCG
AAGTTCCGAGTGTATCTACTCGGAAGCAAACCGTTCGTGGTCTATACAGACCACGCGTCGCTGCGGACGGCTGTGAAGTCGCCGCACATCTCGCAACAGA
TGGCGAGATGGCTCTCATTCTTCGCAGAGTATAACTTCCGGGTTGAGTACAAACCCGGAAGACTCAATGTGGTGGCCGACGCGCTCTCGCGTCGACCTGA
CTACGCCACGACTGATGCCGACGTCGATGCCATTGACGCCATGCGATCGAGCACCCCAACGTCGTCACTGTTGGACGACGTGAAGGTCGCGTACGCGCAC
GATGCGTACGCGAAGCTCTTGCTGGCCTATGGCTCAGCGCCTTCTGACAAAGCTCGTCAGAAGCTGCCGAAGCATCTTCGTGCTCGTGCACACCGTTATC
GGGTGCACGACGGGTTATTACTCTACAGTGCAGTCGACGACAACGCGGACCGCGTTGTCGTGCCCAATGACCATGCCCTGCGACTCAGGATCATGTATGA
GTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACATACCTTCTTCTCATATGGGACTTCTACTGGGCCCACCAGTATAAATGGGTGCGC
AAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTATGAAGCCTGCGCCTTTCGCGCAGGCTCCCTTGGAGTCACTGCCGACTCCGCCGGAGTGTTGGCAGT
CCATGTCTTTGGACTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGAGAACACGGGCGTTGTGGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGC
TGCGGTACCCGCTGAAGTGACTGCGAAGCAGACGGCGCGTCTGTTCATTGACATGGTGTTCAAACACCATGGCATGCGGATCGACATTGTGTCGGACCGA
GACCCGCGCTTCACCGCACACCTTTGGCAAGAAGTGTTTACACTTCTAGGGAGTCAACTTTCAATGCCGACTGCGGACCGGCCACAGACGGACTGGCAGA
CCGAGCGCGTGAACCGCGTGCTTGTAGACGTGCTTAAGAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGATGGCAGAGTTCGCCATCAA
CAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCCTGAGTCTACTCGGGATGGTGGCTCCTTCTTTA
AGTGGGGGAGGGTCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACTGTGTCAGCCGCGACCACTCGCAAGAAGAACAAGAAGCACA
CGTCTGTGCAGGGCACAGACGCCGCCAAGAGCAAGAAGAACAAGAAGAACGGGTCTGTACAGGGCACAGACACCGCGAAGACGAACGCAGAGGCCAGGCC
TACTGCTGGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGCGCGGACAAGCCGTCATTCGGTTTGCCCAAGACGCTATTGCAGCT
TCTGTTGATCGACAGAAGCTGAACGCAGACAACGACAAATGAATTCAAGAAGGTTCATTGGTTTTGTTAGCTACTCAAACCCTGCCTAACATGCAGTTTC
CAACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTTATCGGGCCATTCACGGTGTTGGCACGACATGGCATAGCCTACACGCTAGATATTCCATCTAGCATG
CGCCTCCATCCGACCTTTTACGTCGGGCGGCTGAAGCCATACCGGCAGCACGAGCCACCTAGCTCGGCTGGCCCGAAGCGGAAGGCCCAGCGGGAGCGAA
CCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGCGCGACGCGACCTCCCACGTCGACAGAGATGTCCGACGCGGTCTGCGAACCCTGAGCGACTTGA
GCCCTCATGATCGCCCCCTCCTGCTTCAGAGCGGCGAACACCCGGCTCTGATGCTGCTCCACAGCAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAA
CCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCACCGCTTCCGATGCGCGACGCCCGAGGCTCAACACGCTGGATTGTTGAGCGTATTGTGGACC
ATAGTATCCCGAAAACGAACCGGCAACCCGTTCGTTATCGTATTCGTTGGAGAGGGTTTCGGCCCCACCAAGATACATGGGAGCCGCGGGACGTCCTGCT
GCAGGACATTCCGGAAATGGTGAGGGCGTACGAAGCTCAACACGCACTGCCGGCGCGTTGGTAGTGCGAGCGCTGCAGTCACCTGCAGCGCCCGAAGTCC
CACGATTGTCGCGTTCCTCGCGTGCCAGGAACTTGGCACGGAGATCTTTGAGACAAACAGGTACACGAATTGTCGTGTACCCGTTTAGGTCGCGGTCGCT
TAAGCGCGCCGTACCCGGAAGACCAATAATAATCGCGCCTTTGATTCGTTAACGGATCAAAGTGCTGCTCCTCCGCAACAGCATCGTCGTGGATACCGCT
GCATACGTACACCGGGATTTCGTTTGGAGGCACGGTGTTGCCTACACGGTCTGCGATCTCTGACGTAGACGGCATCCACGGATCGCGCGCTGCTCCGGCA
GCGCGCGGAGAGCTTGAATACGCCACTTCACGCGGGGAGTTTAAAGCCCCTGCAGCAGAGATCGGAGTGTCGCTCTCGCCGCGCGAACGCTTCGAGCTTG
AAGCGTCCGAGTCGTCTCCTTCACGAGGGCGTCTCGACCCGGCATGCGGGTCGAGACTATTGCTGTCGATAGACTCCTTGCGCTTGCTAGAAGAGGCCTC
GCCCTCTTCCATCTCCACGTCGTCGTCCCCGTAGTCAACAGCGTCGTTGACTACAGAGGAACCTTCGAGGACAATCTCCGGTTGAGTTGTCCCCGCCGCA
GCCTTGGCAGCCAGAGCATCACGCTTTGCTTTGTGACGCTCGCGGTACTCGGGGATAGAGAGAGTCTCTATCGCGGCGGAGGTCTACCCCTCTGCTACAG
TGTCGGTCTTCTTCGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGAATTGACGAATGGTCAATTTCCTGATTGACGTGCCG
TGACTCGGCGCGTCTAACCTTGAGGGGGGATGGTGTAACAGGGTTACACGCACAAGTGGCTACAGTCACTTGTGACTCTAACAGACACGACGTCTGTCAG
AGGTTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAAGGCTACATACATTTACGATCACCACGACGGGTGGTCCATAGAGACTTAGGATTCCTAT
TGGCTGAAAGCAGCATCTTTTAGCCGATGAGCGACATGCATAGCATTGGAATTCTGCCAACCGGCCGTTGGCAGATTCCTAACTTAGAATATTACATTTA
GAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAAACATTATTTGGATCGTTTATTTAGATTAATCTATACTCGGAGGTCCGA
GTATAATTAACTAGTTTAAACTAAGCTACGCTTCCTCATACACGTGCGCATACGTGTAAGCCGTAGTAGTGAGCCAAGGTAGACCCATTACA