Description :
From Genome Similarity Track
Location :
contig_3:391393- 392890
Transcript NameFunction/comments
g922.t1POM78190.1 Amino Acid/Auxin Permease (AAAP) Family [Phytophthora palmivora var. palmivora

Sequence
1497 bases(100 bases per row)
AGACTCATGCCGTTTGGTTGTAGTAAATCGTGTTCTGGAACTCGGGCTCGCAGTACGGGAACGTGGCATCCGAGTCCGACGGGGCGAACAGGTTCTTGCC
GGCTGTGTACGTTGAGTAGCAGCCGAGGACAAAGCACACCACAAGTACGAAGACGGCCGGGACCCTCTCGTACACCGGGACTTGGTTCCACGTCTTGATG
AGGTAGAAGATCGTCGGCAGGAGGATGCAGTTCGCTGTGATAGCCGACGCTCCCACGAAGTCGGCAAAGTCCGAGAAGTGGTCTTGGAAAATGATTGACA
GCACCACCAGCACCACGACAATAGTGACCCGCAGCACGATGTACTTGATCGTGTTGGACCCGCGGTACTCCGCGACCTCCTCTTCATGAGCGTGATTCGG
CTGGTACTCAGTGGCTGTCACCGGCACAACTGGCGTTTTCGATCGACGGTCCGATGAGATACTGATGCGAGCCACATCGCTCTGCAGCAGAGTCTGCTTG
GAGATATCTTCCACGGGCGTGCCAGCTTCCTGGTAGGCCAGACCGTTTTCGATGTCGTCTGGGGTCTTCTGGTGCATGCCAAGTACTAAACGCTCAGCGA
TGTAGAAGGCCGGGTTCAGCAGAACACTAAACGCGATGGTAATGTGCATCTGCATAGCGAGGTATGCGAGTACGACCGAGCCCCACTTCGGTGCGAAGCC
TACCGAAGTGAGGCCAGTGCTGGAGTCCGCGTAGATGGTGTACAAGATGTTGCCTCCGCCCTGGCACCCCATGGAAAAGTACGGCACAAGGCCCAGAACC
ATGAGCATGCACATGATGAACAGCATGGTGGCGCCCACAACACGGGGCATGCGGGCAGGGTCGCTGTGCTGGCGTTGTACATCCGGAAGCACGATGCCAG
CGCCGTAGCCGAGCGACAGACTGCCGAACGCACCGATCACTTGGCCCAAGTCGAGATCGGGTGTCGGAATGCTCGGGTGGCCCTCCATGCCGTGCACGAT
GATTCCGATGGCAAGACCGTCTGCAACAAGTGTGCCCATGCAGCCCGCGAAGGCCGCGCCCGCTCCCTCCTTCAGCGTCGGGACTAGACACAGAGGCAGC
ACCGTCACCGCCATCAGGACGATCCAAACCGTGGGGCTGAAAGCACCCGGGAAGAGTCCATCTAGCAGTCCTCCGCCGAGAACGAGGAATACGCACGGGA
TGAGCAGACAGGAGCCCATTTGCGAGATCACTGCCAGCCAGCGGCCAGTCTTGCCCATGCTCCATTCACCGAGGTCGCTGAACGTCTTGACGGATGTCGG
GGCCAGCAAGAGCACCTTCGACATGGATACCGAAGCGTAGATGTTGGCGAACGCCATGAAGGCGGTGGCAAAGAACCCCAGCACGGGACCCGTGCGCGCA
AAGTTGCCCGGCATACCGAGCGTGCCGATGCCGCACATACAGCAGAACAGGCTGAAGGCCATCTTGAAATCTTCAAGTGTGAAGAAAGGTTGCTTGG