Description :
From Genome Similarity Track
Location :
Scaffold_25:391379- 395478
Sequence
4099 bases(100 bases per row)
GTGCATGCCGCTGGGAGCGCAATATGCCACGCTTGCTGCCAGGTTGTGTGGTCTTCTTGGAGTGGTGAATACAGCAGAAAAATCTGCTGCATGAGGTCCG
ACCTGCCTTTTGCAGCTAAATCAGCCAAGATGTCCGCCGCTCTCTCTTCGTTCCACCGAAGCAGCCCGATCTCGAGCATCTTATCGACCAATTCAGGAGG
AGGGCGCCAGGGACAATAATCCAAGAAGTCTTCTCCATCAGGTAGTAGCCGCTCAGCGAGCTTGTAGTTGCCAAGCCTTAACGCGTGTCGGATAGCGAAT
GTTAGGTCGGCATCTCCAAGCTGCAGACCATCATTTAAACATTCAATGAGTTGTCCAAACTCAGTCGCCCCCTCGATCACAAAACGCCCCCAATAACTCG
CGTCATAAGTGTCTTCAACTCGGATCGTACACTGGCTTTGAGCGCCGTCGCTGCTTCCCTGAACTGATTCGGTCCTCGTTGTCCGCTGACCGATGCCATC
TTATGCGTTGGATCGACGCTCCCATAGAAACTTATACACACGGAGGTGACCGCGTTCTGCGGCGGTCTTGAGCAGCCTCTCTCCGGAGACTTCAATGCCG
GAAAAGTGCGCAAAAAGCCACTCTAGAATCGCAATGTCACCTCGCTCAGCGGCTGCAAGCAGCGACTTCATAAACTGCCAGCGGTAATAATGCTGATCCG
AGCGCAGATAGTTGGTCAGCGTCCATCTCGGGGCTCTGTTCTCGGCGATCGTGCAGCTAGCGGCTCAAATCCACTCCAACGTCGCAACGGTTCCGGACCT
GCAGGCCTCGCTCAGTAGGAGACTTGGCGGTGGACCCAGAAAGCAAGAGATTGCTCTGGTGTTACGCTCGAAGCTCCCCAGGTCGGGACACTCCTGTAAC
GCGAAATCCACCACACACGTAGTCATCGCTCGTGAATTGGTTGGATGAGGACAAACAAGATGCCGATGATATTTTGTTTCGTTTTTGAGAAAGGATCAGC
CTTTTTGAAATGATTGATTGTTTTGTCAATTGGTCTCGAATGTAGCGCTTGGATGATCCCAAATTTCGTTACCGGTACTAACAAGGTCCATCTCTAGTCC
CATCGATTTTGCCGCAAGATGCAGGCACTGAGTGTCTCCAGTTACGTGGTGGTTCAGTTCCGCGATCCATGTAACTTGCATCTTACCACCTGGGGACAGC
TATTGTCGACGGCATTGCGCCCTCGGCACACCGTTCACCCCATTAAGTTTGTCGCGGTCCTCCTCCGTTAGGGTCGAGTACTTCGGCCAACAAAGAGTAG
ACGCGTAGCTTGCTGGTAAGACGCTAGAAAAAAGGAAGGCAATCTCGGTAAAATGCAAAGGGTGTTTTGCTTTCAACGAGGAGAATTCACGACTGAATCC
TTCACCACATCATACGCGGCCGACGGCTACCCCGCCGGCCCGCTTCCTTTCCTACTGCAACCACTTGGGGACGCCACACCTCCCGTGCACGAGCTTCCTG
GCGTCCATGACACCCGTCCTTGGCGGCTGGCGACCGAACGTTCCGCGCCCAGCCCGCCATATCGCGTCATCTTTGCCTTGAAGAGTGGGATAACCACTCA
CACTTGATACGCTTGCCCGTCCTGCCCTTGCTCCTCTTGAAGTCGCGCCTCTTCCTGCTCTAACGCGCCTTCGAGCATCGTCAGGAAAGCTGTCAGTCGA
GGTCTCAGACGTGACCCGTGACAATATTCACGTAGCCATTGCACAACCAACACCAAGGTGACCACCATCAGCAGCATTGTTATGGTGTCAAGCGAAAATT
ATATGTACAGCAATGTGTGCCCGTGGGATTAAGCCGTGAATCAATTTTGCTACCAAGTGTTGGCAACAACAATGCCAACTGCAATACAGTGTATTCATCA
CCATTGGTGCCTGTCATCATTGTCATCTTGTTGACTCAGTAGAATTGTGCTACATACGATAATTTTCGCTATCATCAATTTCTGGGAGCTTCCAGTTCTC
ATTGCCAATTTACCTTCCAGCCGCCAAACCCCCAGTCCCAGCAAATACAAACTATGCGTCTTTCTCAAGTTCTAGCGATGGTCGCGGCTTCTTTCTTGCT
CACCTGTGAAGCTCTACTAACGACCACAGTCTCCACCCAACTGAAGATCTCCGAGGGGGTATCCAAAGCCAGCGATTTCTACGGAGCAGCCGTGAAATCT
TTGATGACGATGACTCCGACGAGGACATCGTTGTGGACAATGACTCTTCCGAAGACATTGCTGAGGACGACGACGATTCTTCCGAAGAGAGCCAGCTCAC
AAAATCTCAAATGAAGGCACTTCAGCAGGCCCGTCTTGTCAATTCACTCCCAATCCGGATCGGCTCGCTCCCAATCGTCCCACGGAACGCATCCGTCCCG
TCATCGCTCACCTAGATAGACGCCTCCGGGATCCCCACCCGGTTCTCCACCTGGTTCGCCGCCGCCCGGTTCTTCACCTTGATCGTCGAGGCGTCGTCCT
CTGATCCCGCCGTTGTTCCCGATCGGCACCATGATCCCGGGTTTCAACGCCCCCCAGGGCACTCATTCAGACTGATACGGACCCCTGGCCTTTGATCTTG
CTGAGACAGCTACACATCACAGCCATGATCCTGTCGACGCTGACCCACCATCTCCTCCTACCCGAGGGGTGGCTCTTCCCGCTCGCCGTTCGGGGCACAG
CACAGCCTGCCGCCGGGATCGGCTATCGAGACGACCTGATCACCGGACCCACCATTACCGCATTGATGGCCGATCGCCCCTGGCAGGTGCTGCGGAACCC
GGCCAACCCGTTGACTTTCGATCTGGCGCTCCATCGAGGCGCCGGCACTCGATTGGGTCGGATCGCCATTGCCTATCTTCAACTCGAACAGCAGCATCGC
CAGGCCTTTTGGGAAACCACTCATTATCTCCCGATCACGGCCGCACAGCGTCGGGACTCGATCGTTGAGCAATACCATCGCGATCGCCGAGCCCGACGGA
TGCGCCTCGGTGATCGGTGGCGCCGACTCCTCGACGCGATGCTGCCCGTGATGTGAGAGATGTGGGCAGACGTCGATCTGCTGCTGGACCCGTTCTTCTT
GCCGATCTTGGTGCGACAGCGGGACGCTGTGACCTGGTATCCCGGTGTGGTGTCTCGCGCCGCGAATGCTGGCAACCCCACCCAGCACCAAGGCAAAGCG
ACCGACCTCCGAACGGCCCTGATCGAGGCCGACACCCATGCCCTCTGGCGGAACCAGTATCGCGACCACCCCAGGACCTCCCAGCTCAACGGATCCCGCG
CCTCCGCAACAAGTTCAACCCCAACGTCGGCGCCCCGCACCAGCCATGACTTGATCACCGTCTCTGTGATCGACTTCCGTAAGTAGCGAGCCAGTGGACC
ATTACACCCCCAGAGTCGGAGTGACTCGGAGGCCGATCTTCCATACGCGTCACGCGAAATGTTCAGATTAATCCATGCCATCGTAATAATCCACATTCTT
CCTTGATCTCCCGCTGTTCCCCGTCAATCCATTCGTTGCTAACTCGATCGGCCAAGATCTGTCCTCATACCTTCCTGTACTCGCTCCATAATCATCCGTT
CTGCACTCACATACCCACATTCATTCATATACAACCCCTTCCTCCGATCAACGGCCTCCCCGTCGATCCGTCATCTATCTCGCTCACCAAGGTGACCAGC
TCACCCTGGCGGTCCGATCCCACTCCTCCTCGTGAGACTGCATCGCGCCAAATCGGCTCCGGTTCCCACGATCCCGAAGAAATTCGTGCAGTTGGGATCC
GCAGTTAAGATCCGCTTCGTCGATCCCGTCGGGCTCGTCGTAGCCCTTCCAATGTACCAGGAATTTTCGATAAGTCCGGTCGTACCGCGTCCTTCGACCC
GTCCGCATATCCGTGATCTTCTCCACTTCGTACTCGTTCGAGTCCCGATCTGGGGCCCAGCTGTTCTCCGGAAGTAAGACTTCGTCGAAATCAAGTCGAT
CTGCTTCGTCCACTCTGAGCGCGATCCTCGGTCGATCGGGGAAGTCCCTGACCAGCTTCAGCTTCGACACATGCACGATCGGGAACAGGTGATAGTCCT