Description :
From Genome Similarity Track
Location :
contig_29:391362- 392950
Transcript NameFunction/comments
g7158.t1XP_009519606.1 hypothetical protein PHYSODRAFT_556912 [Phytophthora sojae

Sequence
1588 bases(100 bases per row)
AAGCCGAGACGAAGGAGGGGCCATCTTTGGAGACGATGTTCGAAGACGTGTACGACGTCAAGACGCCACACCTGCTGGTAAACTACGCCAGCAATATCTA
CGCTGCGCTATGCATGTAGCATACCTAACGCTATCTGTTTATTTTGCAGGAGCAAGAGCGTGAAATGATGGAGCATGTGGCCAAGTACCCTGACCACTAC
ACAGGAGAGCATTAGCCGTTCGAGGGCGCTCACAACTTCTGCAAGATCAGAAAAAACGTTTCAATTCATAGAGTGCGCTTACATGTTGTCCTTTGCCTTT
TAGAGGTAATGTGGCTCTCTCTGCTAATCCGCTAGGCTGGTCCAAGTTTTACAGTCATGCACCCACTTGCTTCACGATGTACGTTTGGTCGCATGGGCCA
TGACGAAAGCGGCACGTCCAGTACTATTTCTTCGGATGTCGCTACAATGGCTTGCTTGACATCGATGTACAGCGAGCGCAGAGCCATCTCGGCCAGTTCG
CCTTCGTCTTCACATGGACGTTGCCTGCTGGAGGACGTACTTTTTGAGGTGTCATGTCGAGGAGCCACCACAAAGCAGACGTTTGGTCTGCCTGACTGAA
GAGCACTTATCGCATCACTCACAAGTTGCTCTCGATAGACTTCATCTTCGAAAACCTGACGACAGTGTTGAACAGGTATTGCGTGAGCTGCTATAGACTT
CATACGAGCAGGCTTGGTTATCTCGTCGTTTTGTAGTTCCTTTTCCATGGCCACCATGTCGGGTGAAACCTGGTGGTCGTTTTGCCGACTGGTCTCGTTC
AGGTCAGCAGCCCTCGTCAGCTCTTGGTGTAGGGAAATGGAATTGTAGCCGTTCTTCGATTCAACTACGTCGTTGACATCGACTTTAGGACCAGTGAAGT
GCCTTTCAAGCGGTTTGAGTGCCAGGTTCTGCCACATCGCTTCAATTCGAGTCTCGCCATCCCACTTGGGGAATAAATTATCAGGTGAAGATGAGAGTGA
GGTGAATGTTGCGGTGGCTGTCACAGTACTTGGGTTTTGTTTTCGCGTCTGGGACGTACTTGTAGTTTTCACCAGAACGGAAGGCGGTTCATGCTCCGCA
AGCATTTCTTCCATTGCTGCTAACTCGTCCAGGTACGTCTTCGGCCTTTTTTCAATCGTCTCGTGTTCTGGCATGCTTGACTTTTGGGGATTGATACTCA
GAGGCAGCGCAGGAGCTGAATACGAGGCATAAAGTGAAGACAACGTTCCAGACTCGTGGTAAAGAGAGGGGAGCTTGCGCGGATGGTCAACGTACTCGTT
GAACGACTTGGAATGGGCTTTTTGTCTTGACACCGCGATGATGTTGGAAGTAGCTGGCAGTTTTGGTGTTCCCACTGTCAGTGTCCACTGCTGCCGAAGG
GAGTGATACCGCCTTAGACACGCACTACAAAGGGGCTGCGGCTCGTACAGCTGACTGCGATCTCTCTTTGGAAGACGATGCTGCAAATGAAATGCTAACG
CCGAGTGGAACTCAGTAAAGCCTCCAGCCAGACTCATATCCTGCTGCTGAACAAAGTCATCGAAAAACTCGCAACTACGCAGCACTTT