Description :
From Genome Similarity Track
Location :
Scaffold_226:39131- 40735
Sequence
1604 bases(100 bases per row)
CCCGTTACACCTGGTAGCACGTTGTAGTCCGTTCAACGACCATGAACATGTTGGACGATGAGGGGGATGATTTTCATCCCACGCATGAGAGCTACATCCA
TTTGAGTCAAATCGAATTGGATTCCGTCGAACGACTGAGTTTGACGATAGGGCAAGTAGTCGGTGGCGCAATGCTGTCCGCTCTGGGTCCAGATGGACAA
CACGCCACCATCTCCAAGTTCATCCAGAATGATCTTGACGCTGAATGGGAAAAGGTAACCTTTCTTCACCAACCAGTTTCTTAACAGACAGAGCTGTTGA
GACAACAGAGTGCCCAACGATTTGAACGGTCGAGACAGGAGCAAGCTGCTACTACTGGATCGACACACATACGTCGACCAAAATCGCTGAAGATTGACAT
CTCAAAGTACAAGGAAGCTGAAGAAGACTCTATGTTGAGATGGATTGTTGAGCTGGACGACGGCATAAGGGTGCACCTCATCGTCGATGACTAAATGCAG
GTTGCATTACTAAATCGAAATTGGCCGGCCATGCGAATACTTAAGCTTTGGGCCTCAAGATATTCGACCCATATGTACTTAAGTCGTTACGGGTCGTCAA
ATCCCGTCTCAGAAAAATATTCTTACCGCAAAGAGCTAAGTTCAGGGCTAGATCTAAAATCCTGAAATTCAAAGAAGGCAAACGTGATGTACACTCCTAT
ATTCAGTACATATGTCACCTTGCGAGTTGAATTAGAGCAAATCCGCTGGATGAACGAACGGTGATCACGTTGTTCACGCAATGTCTCATGGACGGTTCAG
TCAAGACCTACCTGTTATAACTGGAATTTGATACCCTGGAAGAGGCGATCCGGGTTGCGGAACACGAGAACTTCAGCGTGAAATAAGCTCACGTGAATTC
GAGTTTATATCATACACCCCCCCGAGGCAACAGGAAAGTGGAGGCCCAGACCCAATGGAAATCTGCCACGCTGAGAGTAAAAGATCTCGCATAACCGATT
ACAGAGATGCAATAGAGGTCAAAAGACAGGAAATTATGCATAAAAATGTAGTGCTTCAAACGCGGTACCTTGTACCGCATGAAACAGTAACCGTCAAGCG
AACAAGAAGTGTCCAAGGCGTGGGTCCAATCCTGTTGCGATCCCGCAACATCGTAGCGGACAGTCAAGAACGGTCGGGGTCAGAAGGTGCGGAGCACCCT
ACTGATTTAGCAAAGTCAATTGAATTTTCAGGACTATTGACGAGAGTTTCTTCCAACACGCAATCATTGTATGTTACTGCATCTTGAGGTTTCCATTATT
ACCTTAAAGCTCGAAGTGGCAACGATAATATTACTACGATCCCTAGTCGATGTTCGGGCGTCGAACAACGTTTTACGATGCCAGTACTAGAAGAAAGCAA
GCATAATTTCATTAAGCGCAAGATCTCTCCAACGAGGATGACGGTACGCCTCGCAACAAGCTTATCCTTAATAGCGAAGGAACGTGTAGTGAGAATAACC
AATACACTGCAAGAGGTCCAATACGATGAAGTCGTCAAAGCACTGGACTTGGACGAAAAGTTTGATGTCATTCTTGGCTTACCGTGGCTCAGAAGGTATG
AACC