Description :
From Genome Similarity Track
Location :
contig_162:39131- 40479
Transcript NameFunction/comments
g14483.t1XP_009517233.1 hypothetical protein PHYSODRAFT_473346 [Phytophthora sojae

Sequence
1348 bases(100 bases per row)
GCACGCGTCGAAGTCCTCCGATGTCGTGTACCACTGCGTCGTGCACAGCCACTTGGATTGACACGCGACGTCCACGCACGACGACTGCAGGTACGACTGC
GCCTTCGAGTTGTAGTAGTACTGCTCCAACAAGGTCGGGTCCGACGCAGCTCGATCCACGAACGCGTTGAGCTCCGACGTGCGCAGTGAACTCACGCCGT
ACTCGGTGCTGGCCTTGAAGAGCGGCCTCCAGTCGAGTTCTTGGGTCGTGGAGACGTTGGAGCCGTACACGGTGAAGTCCAGCACCTCGTACGTGGTGGC
GTCGAAGTCCCAGACCATGAACGCCGGGTTGTTGTTGTAGATTGGTGAGATCGCCGCCGACATGAATAATGGTACCAGCTCCGCACCATCGGCCTCTTGT
TGAACCTTCTGCTCTGATGTTAGTGGCACACGGAACTCGATGCTGTGCACGTGGGCGAAGAACTGCGCCTTGATGATATCTGCGAACTGGTGCACGATCT
CCTTGTAGATGACAATGTACTCGGGTTCCCACATTTGCGCGCCGCTGTACGAGTCAATGATGGGCGGGATGTGGCCGACGACGTACGCGAACTTGTCCGC
GTTTCGAAGTTCCAGCAGAGTTTCGTTGAGCCATGCAAATTGCCCGAACGGGTCCGAAATGTTCGTCGTGTCTGGGGAATGACTGGGCTGAATCGCATGA
TACCAAGACAGTCAGATAGGCTGCTATATAGCGCGATGGTAACACCACCGGAAGGACATATACAGCAGCTCTTTACCGAGTAGGGCACCGTGTTGAGCGT
CAAGACAACAAGCTTGTCATCGAGGTCATACGACAGGTAGCCGCGGCGGTTGAACCAGTCGAGGTTGGACTTGGACAGCGTATCTTCCCAGGCTGCTGAG
ATGAGTGCGATGGACGGGTTGACCTCCGTTTCTGGATCGGTCACGTTCATGTTGTAATCGGGGGCTGCGAGGAAAACGGAATGTGTTAGTGGTCATCGCC
CGAAGCGCATGTGATACATTGAGACGTACTTGTGTCAGCGTTGCCAATCAGGGCAGTGACGTCCAACTTTGTGTCGTTATCCTTGGTCGCGTAGTATTGA
GCCATGGTCTCGACATTTGTCTCCACTGTCTCGGCCTCGAACTCTTCGGACAGGTCACCGTGTGCGACGTGGTCGCCCGTGTAGAGGAAGAAATCTGGGT
CGGGAATCAATTCCTTCGCGAACGCGAGTGCCGACGTCAAAAGCGTAATTGGCGCGTCGTCTCCATACGTGAGCTTAATCTCCACGGACTCTGTGGCATC
CAGCGACTCCGAAATATTCAGATGAACATCGGAAAAGTGCACGATGTG