Description :
From Genome Similarity Track
Location :
Scaffold_276:3913- 6115
Sequence
2202 bases(100 bases per row)
TGCTAATCCTTAACTTCTAAAACGTCTTGGGTGTAGCCAGGAGCGGGATCGCGAATGGCTGCAGACTGGAGGAGTTTTTGGTGGCGCTTGATTCTGTCGT
TTAGGTCTCCCTTGCTGTGAAGAGCCTGCATGTGCTTAAGGACGGCGCTCGACCCACGCGAGCTGATCTTCTTCTCGCCACTTAGGAAGGTAAGTACGGC
TTCCTCTGCTTTCTTGCCCACCTCAAGAACACAGTCACGATAGTCGTCAGCATCTTGGTCAAGAACAATGCCGTCTTCAAGAAAATCTTCATGAAGACTA
CCAGCAACTTCGCTCTCGACCGCTTTTGTTTTGGCGCCAGTGCGTACCAGCGTGGATCTGGAGCGTACCACGCAAACCAGGTAGCATGAAGGTGAGTTAG
AGATCCCCTGCGTTGTTTCTTGCTTAGCGTGCTAACGTCATCTGTGCCTTCCTCTGGACAGCTTCGTTTTCTTGGTGTAGGCTTGCTGTTTTGCTTAGCT
TCGAGTGCATCTATGCGAGCGTCCTGTCGCTTGATGTGCTCCATAAAGTGCTTAATCACAGCCGCTTGGTGGTCGATGGTCTTCTGGTTCTCGCTTGATT
CTCTTGGCTGTTCGTCGTCGTTGTGGGTTGCTGCATTACATGTCTTGGTGTCTTCGCAGGTAGTGGATGGGGTTGCCAGGTGCGAGGACCATGCGAGCAG
CTCGGCTGGTGAGCATCCAGCGTGATCAACAGCCGCTTCGATGCGCGTCACAGCTGGACTTGTGGGGTTCAGGTCTTTGAGTAGCGGGAAGTGACGGAAG
ACGTGTGCGGTGAGGACATCCATTACCTTCTTGTTGATGTTTAGGCTGTCGGTCTTGAGCTTAAAACAGGTAGCAAACAGGATACGCTGCACCCGATCCA
TCGCTTCACGCGTCTGCGTGTCAAAGCTAGTCAAGTCTTGCAGCGGCACCGCGGTTCTGGGTTTGTATCCGCTGAGTACTTACGCTATCTTGTGGTCTTC
TTTGCTTGTATTGAAAATGTAATTGAACCCTTTGTTCGTTGTGCTTAGATTCCAGGAGCCTCTGTCAAAGATCCAGCGTGCAGTCATCTGGTCGCAGCCG
TTTGCGCGCTGAGCGCCTCCTCTTCGAAACGAGTGGGATGTCAAGGCGACATCCACACCAGCAGCAGACGCTACACGGTCTAGCACCCGGCTAACGTGCG
CGTATACTGTAGGGGCTGTGGCAACGCGCGGCGGAGCTGCTGGAGCGGCAAGACCAGTTGTGACTTGCGGAGCGTTGAGCAGCTCGATCAGCAGGACGTC
GGGAGAAAGCGTGGAGCTTGCGAAGCCTGCTTGAGCTGGGAGGTTGCTGACGAGGGCTGGGCCTGGGGCGGCTTAGGATCAAGGCGAGCGCAATGGAGAG
CAAGGGGCATGTAGCCGTTTCCGTATCAGGAAAGAGCGACAGCCCCTGCTCCTCAGACGTCTTCACGCGAACCAAGCGCAGAAAGAAGACGTCGCCTGCG
TCCACTGAAATGTTGTGTTTGCGGACCATGGCTAGGTCAGACGCACGACCGAACAAGTACCAGAGAAGACGTAGTAAAGTTGCATCTTGATCGTCACTTT
CTGAGCTAGCATAAGTGTACAAATACAACATCATTCTTTTCAAATCATTTTTCGTACAAGGTGGTGCTTTCGCTACGAGCCCACCACCATCTCGCTTCAG
ACAAAAGTTGTCTGGTGTCTTTCCCATTTTCAGCAACCGGGCTTCCAATGAAGCTTGGTGCTTAGGGAACTGATCGAGCAGCCCAAGCTTGGCTTGCCGA
TACTACTGCATGGCTGTGTTGCGAGCTATTGGCTTACCTTTCTTTCCTTCCTTAAAAGCAAGATACGTACCAAATTTATCCATCACACACACGAACATTT
TTCCGCTCTCGTCACTATCAATGCACTTCCTTATGTATTCCTGTTCAACTTCCTCTTCTTTGAGAATTTTGACGAACGCACCGATGGCTGTTGCCTTAGC
CCGCAAGGTGTTACCAGGCTGTAGTTCGTCTAAGCCCATGTCACTGATCCACTGGTCCGATAAAAGCAAAATATGCAAGTGATATGTCAATGACTTAGAG
TTTGGATACGCATACACATATTTTGCGTATCAATCGGACGTGATACGTCCGATCGGCTGGCGTGGAAGACTCGCCTACCCCTATTCAATTTGATTGGTTA
AA