Description :
From Genome Similarity Track
Location :
contig_3:39124- 42056
Transcript NameFunction/comments
g883.t1hypothetical protein

Sequence
2932 bases(100 bases per row)
ATCGCACTATCGCTATACTAATTGCGGTGCCTACGATTCTGGTGGACACCCAGCTGCGGACAGTTCTCTTGTGTCAAAATACTGTGGCATCTACACTCTT
CGGATCCTCGCTCCTCGCAGCGGTCGAGATTGCCGTGCGTCTGGCAAGAACTCTTCACGTAGCACGCAAGCATCGCTCGTTGTCCCAGTGCGTATTGCAC
GTACCCAGGACTGCTCATGTTGTCCCGCAGCCGCATTTGGCCAAGTTTCTCTCTTCAACTTCTCTGCCAGACCAACGAAGGCTAAGCAGAGCCAAGAAAA
TGATGGCGCTACATGCTGCTGAGGTGTATACCGACATGAACGCCGAATACATCGCGATGGGCTGTTCCTACGCGATTCTGTTCTTCTTTGGTTCTCATAC
GAGATTCAACCTGGGTGATCAGACTGGTGCCAGCTACTCCATCTTCCCTGTCACGATAGCTCTGCAAGTAGGCATCGAGCTGGTGGTTGACTTTGGGTCA
AGTGTGTTTGAAATTCGGCTAGGAATCGACTTCGAGAGTTTCAACGAAGACGGTGCATACCTCGCGTTTTTCATGATGGTTATCGCAATCACCAACATCC
ACATCTCGTCGGGCATCTATCTGATCACTCACTAGATGCAAAATATCCTTCTGCATGTAGTCGTGCAAGCGGTGAAGACTTCACAAATGTCAATAATTTA
TCTCACAGTTTTGGTCGTGCAGGTTTCGAATTGGACTTGTTGCGGCTCTGGTGTCTCATTGTCAGGGACAACCTCATTGAATCAACGACGAAAATGACGC
TAGCTATTCGCAGCCGTGCTCAGGTGGTCGCAACTCGCTATTTCGAGGTAGTTCAGCAACTCTCAGCCCCGCTTCATGCGCGATAATTATCTGACTACGC
TTAATGCCGGTCAATAAGGGCAAGACGTGGGCCCAATTGGTGGTCAAGGTCCGGCATGACCGCGTGCAGCCTCTCACCCAAAGTTCAGGAACGACCTCCA
CTCACCAACGCATCAGCAGCTTCGGATCCCGAGCTCACCCTCTTACTATCGCATGGTGCACCATTCGGACGCTGGGCACGGTGTTAAGCAATTCACTGCT
CAGTGCAGCTATCGCGTGGCTATTGGCGTTTTGCATCGACCAGGGCAACATTTTCTCCTCAGTGACATCGAAGGAGCAGCCACATGCGGTGTTCCTCACG
GCAAAGATGATTTGGTTCTGGATCTTCGCTTGGGTATTCACGATCGCCGAATGCGTGGCTAAATTGCTCCCAGAGACGTTCACTTCTCCCTCTTCTTCTA
CGCCGTTCAAACTCTCAGCCACGAAGCTCATTATTAAGTTGGTGCGAGCCATGTTTGTACATATTGTGGGGGTTTCCGCCATGAGTATCGGTGTCGGCTT
TGCCATCGCGTCTGATCACCTCGCGCACAACATGTTCAAAGCTGATGTGTACTGGCCAATGATGTGCTACAACTTCATCTTGACTGTCACCGACGCGCAC
ACGCGCCACATTTTTCGGGTTGAGACTGTGAACGGCAAGGCAAGAGCCCGTCGCCCGAGTCGACATCAAGCAACCCAACAACCGCCAAGAACGCCTCGCC
GAACGCCTTCTGGTGGCCATTTCGTTCGTGTGTTTGTTCAGAACCTGGCTCTAGTCATCTCCGGACTATCTGCTGGTGCCTTTGTACACGTCGCTAGCTC
CATCGAAATGAAAGAGAAGTGGCAGCTCGTATTGTTCGCAATGTGCAGCCAAACAATCAAGCTGTTGATCCAAGCGACCGCCAAATTGTATCTGGGAAAG
CGGAAGAAAACGCCGTCCATGCGCACAATGGCAATTATCGTGTCGGCTCCAACGATTTTAGTTGACACACAGCTCCGAACGGTGTTGCTGTGTCTGGACA
GCACGTCCATGACGCTAACAGGTTCGGTTCTGCTTGCCATAGCGAAGACAGGACTGCGACTCCTAACAGCGCTTCACATGAGGCATCAGACACGCAAAAT
TTTGATCAAGTACCCTCCTCCATCCGTTGCGATGCTTCCTCAAGACAGTACCATAAGAACTCATCGAGTCCAATCGCTATTGTCAGCCCGTGGATCCTCG
TCGGCGCCGGAGCTAGAGGGAATTGCTCGTGTGCAAAAGTTGACGGCTTTGCACGCTGCGGAGGTCTACGCTGACATGCATGGCGAATATATCGCAATGT
GCTGCGCATACGTCATTAATTTGTTTCGGCTCGAATCCGAGATTTGTGCTCGGTGGGAACGCTTCCACAAAGTCTACCCACGAGATCGAGTTGTCCACTA
TCCTGGTGCAAATGGGCATCGAGGTTGTGGTGGATATCATCGCGATCCCGTTAGAGATCCGCTTTGGTGTCAACTTCGAGAAGTTCCAAACGGATGACGC
CTTCCTCGCCATTTTCATGGTCCTTGTCGCTGTTGTCAGCATCCATATAGCCTCCGGGGTCTACATGAAAATTTGACGTGTCAGCACTCTGACAAAAAAT
AATGTGAATACAAAGCGTGGATCTAGCATCGTTGATGCAGTCAAACCTGCTTATATGAGGCATGGTTGGTGACCATACAGAACTCTGACTCATCACACTT
AGTTGCCACACCGTGTGGCTCATATGACATGTGTGCATACAAGTAGCAGACATACTAAATTCAAGTCAAATGTTTGGTTCTACAAGAATTTGCATCTTAT
AGACGGTGGGGCTCAAATAGCGAGGATCATATAAACAGGTTTGACTGTGTTTATTGCTCTACAATGTACCCCGAAAGAGGTACACTCCACCCGACCCCCA
ATTGGAAAGAAAGCGCTGTCCGGCCGACACCACGGGCATGGGCGAGACGGACACGGTGCTGGTACTCATTACCGGAGAGACCAGGGACTACATGTACGCG
GTCGTGGCCAACCTGGGCGTGGCAGCGTCGCA