Description :
From Genome Similarity Track
Location :
Scaffold_134:39117- 40923
Transcript NameFunction/comments
Physo_143286PREDICTED: similar to B230208H17Rik protein

Sequence
1806 bases(100 bases per row)
AAAAACGCTTCCAGATCATTGCTCGGCACGACCGTGGAGAAGTCGGGCACCGGTGTTGTAGTGGAAACGACCTGAAGATCTGAAATATGCAAAGCCGTCT
CGGTGGGGCGCTCGTTGTGAGTAAAACCAGCATTTTCCTGCGTTGTTGGAGGCACAGGTGCCGCACTTTGCCCAGGCAACGGTAGAGATGCCTGAAGAGC
AGATAACGAAAGGAGGTCACCAGCGTCCTGAAGGTTCCGATTGTGGTAGTTCCCCATGCTTTGATCCTGGGGAGGGTTTGCCGGATTCGGTGGAGCCAGA
ACTGAAGTAGCCGACGGCGATGTTTCAGGAATCGGCAAGGACGCTTGGAGCGATGACAGTGACAAAGATGGCGAGTCGCCCTTGTTGTCGTCGTTGCTTT
CACTATCCTCATCGCTCATGAGTACATCTGGACGTTGAACTGCGGGACTGGGAACCGGAGCAGCCTGTGGCATCGGTTCTTCCGCTACAGTTTCCTCTGC
TTGAAGTGCTTCGGGCGTGCCATTGTCTTCATCACTGTTGTCTCCATCCGCGAGGAATGAGTTCAATTCGTTGTGGTTGTTGCCCAGCCCAAGATCCTCA
TCGTCACCACCCACCGAGACTCGATCGGCCTTATTGGTGGGGGTATCTTCGTGGTCGTGTGTGGGAGCTTGGGAAACATCCTTCGGCTCACACTTGGCGT
CATCCTCTGTGCTGGTTGCTGTCAGAGTGGTTCCATCAAGCGAGCCAGGCAATCCGCTGTCCTCCGCCTCGGTCTGCGCACCATTGCTAGCCACCTCGGA
GTCGCCCGCTAATGCTGACGTATGTGTATCATCCACTTGCTCACTGAAAGCGTAGGTGTCATCATCGAGGTGCTTCGGACTCTGGTGTGTGGTAATTTCC
TGAGTGTTTTCTTGAACGTTCTGGTCAACTGAAAGTGCAGCGTCTTCTGTGCCCGTCAACTCAGGTTCTTCTCCCAGAGATACATCACGCTTCACTTCAC
TTTCATCTACCTGAACGGGCGATACAAATTGACGTGATTCCGATTGCGGGGTCGTCGTGATGTTATCGCTTTTGTTCCGTGGACTCGAATGGCGAATCGA
AGAAGTCGAAGGAGACGTAGGTGGAGACGCTGGAGGTGTCGGTGTAACAGAACCGGGAGCACCACTACTGGGAATAGACGGCTGCTGCTGAGATAGCACG
TCTTGCGAATCCTTTGCTGGACTGCTCGGCTGCGCTCGCACCCTGCTTCTTTGGGTCGGTCGAGGCAATGACTTTGGAGGGTGTGGAGATGGTGGAGACG
GTGACGAAGATGTAGGCGGCCTTGGCATTTGTTGACCAGCAGAGCTAGTTTGTTTGACGGCGGTGTTGCGAGGAGATTTTCTGCGTGATGCGTTCGCCTT
TCGTCGGCTCTGCGTTTTGGATGTTTCGCTCTCATCCGAATCCGAAGAATCGGAGTCGAGAAAGCGTTGCTTGTGGTATACACCACCGATGCTTGCTTTC
TTGGCTCCACCAACCGGTGCCACCACAACATCTTCGTCAAGGTCTCCAGCATCATCATCACTTTCATCCTCGGAATAAAAGTGGTCCAGGTCACTCATAC
GTGCTTTTGGTACTTGGAAATCTTCAAGGTGCATCACTTCCTCAACCGACGCTTTCCGAGGACGGCTTGGGCTTCCAGCCGCAGCGGTATCAACATTTCT
TCGCTCAGGCGACACCGGATTCTCTTCGACACTGGCAGAAGCTGTTCCCACTACACTATCTGGGATAGATGCCGCGCTTTCCTTGTGCTCGAACTTCAAC
GGAGGT