Description :
From Genome Similarity Track
Location :
contig_3:39115- 42047
Transcript NameFunction/comments
g812.t1hypothetical protein
g813.t1hypothetical protein
g814.t1hypothetical protein

Sequence
2932 bases(100 bases per row)
CAGACACCGGCAGATCGCACTATCGCTATACTAATTGCGGTGCCTACGATTCTGGTGGACACCCAGCTGCGGACAGTTCTCTTGTGTCAAAATACTGTGG
CATCTACACTCTTCGGATCCTCGCTCCTCGCAGCGGTCGAGATTGCCGTGCGTCTGGCAAGAACTCTTCACGTAGCACGCAAGCATCGCTCGTTGTCCCA
GTGCGTATTGCACGTACCCAGGACTGCTCATGTTGTCCCGCAGCCGCATTTGGCCAAGTTTCTCTCTTCAACTTCTCTGCCAGACCAACGAAGGCTAAGC
AGAGCCAAGAAAATGATGGCGCTACATGCTGCTGAGGTGTATACCGACATGAACGCCGAATACATCGCGATGGGCTGTTCCTACGCGATTCTGTTCTTCT
TTGGTTCTCATACGAGATTCAACCTGGGTGATCAGACTGGTGCCAGCTACTCCATCTTCCCTGTCACGATAGCTCTGCAAGTAGGCATCGAGCTGGTGGT
TGACTTTGGGTCAAGTGTGTTTGAAATTCGGCTAGGAATCGACTTCGAGAGTTTCAACGAAGACGGTGCATACCTCGCGTTTTTCATGATGGTTATCGCA
ATCACCAACATCCACATCTCGTCGGGTATCTATCTGATCACTCACTAGATGCAAAATATCCTTCTGCATGTAGTCGTGCAAGCGGTGAAGACTTCACAAA
TGTCAATAATTTATCTCACAGTTTTGGTCGTGCAGGTTTCGAATTGGACTTGTTGCGGCTCTGGTGTCTCATTGTCAGGGACAACCTCATTGAATCAACG
ACGAAAATGACGCTAGCTATTCGCAGCCGTGCTCAGGTGGTCGCAACTCGCTATTTCGAGGTAGTTCAGCAACTCTCAGCCCCGCTTCATGCGCGATAAT
TATCTGACTACGCTTAATGCCGGTCAATAAGGGCAAGACGTGGGCCCAATTGGTGGTCAAGGTCCGGCATGACCGCGTGCAGCCTCTCACCCAAAGTTCA
GGAACGACCTCCACTCACCAACGCATCAGCAGCTTCGGATCCCGAGCTCACCCTCTTACTATCGCATGGTGCACCATTCGGACGCTGGGCACGGTGTTAA
GCAATTCACTGCTCAGTGCAGCTATCGCGTGGCTATTGGCGTTTTGCATCGACCAGGGCAACATTTTCTCCTCAGTGACATCGAAGGAGCAGCCACATGC
GGTGTTCCTCACGGCAAAGATGATTTGGTTCTGGATCTTCGCTTGGGTATTCACGATCGCCGAATGCGTGGCTAAATTGCTCCCAGAGACGTTCACTTCT
CCATCTTCTTCTACGCCGTTCAAACTCTCAGCCACGAAGCTCATTATTAAGTTGGTGCGAGCCATGTTTGTACATATTGTGGGGGTTTCCGCCATGAGTA
TCGGTGTCGGCTTTGCCATCGCGTCTGATCACCTCGCGCACGACATGTTCAAAGCTGATGTGTACTGGCCAATGATGTGCTACAACTTCATCTTGACTGT
GACCGACGCGCACACGCGCCACATTTTTCGGGTTGAGACTGTGAACGGCAAGGCAAGAGCCCGTCGCCCGAGTCGACATCAAGCAACCCAACAACCGCCA
AGAACTCCTCGCCGAACGCCTTCTGGTGGCCATTTCGTTCGTGTGTTTGTTCAGAACCTGGCTCTAGTCATCTCCGGACTATCTGCTGGTGCCTTTGTAC
ACGTCGCTAGCTCCATCGAAATGAAAGAGAAGTGGCAGCTCGTATTGTTCGCAATGTGCAGCCAAACAATCAAGCTGTTGATCCAAGCGACCGCCAAATT
GTATCTGGGAAAGCGGAAGAAAACGCCGTCCATGCGCACAATGGCAATTATCGTGTCGGCTCCAACGATTTTAGTTGACACACAGCTCCGAACGGTGTTG
CTGTGTCTGGACAGCACGTCCATGACGCTAACAGGTTCGGTTCTGCTTGCCATAGCGAAGACAGGACTGCGACTCCTAACAGCGCTTCACATGAGGCATC
AGACACGCAAAATTTTGATCAAGTACCCTCCTCCATCCGTTGCGATGCTTCCTCAAGACAGTACCATAAGAACTCATCGAGTCCAATCGCTATTGTCAGC
CCGTGGATCCTCGTCGGCGCCGGAGCTAGAGGGAATTGCTCGTGTGCAAAAGTTGACGGCTTTGCACGCTGCGGAGGTCTACGCTGACATGCATGGCGAA
TATATCGCAATGTGCTGCGCATACGTCATTAATTTGCTTCGGCTCGAATCCGAGATTTGTGCTCGGTGGGAACGCTTCCACAAAGTCTACCCACGAGATC
GAGTTGTCCACTATCCTGGTGCAAATGGGCATCGAGGTTGTGGTGGATATCATCGCGATCCCGTTAGAGATCCGCTTTGGTGTCAACTTCGAGAAGTTCC
AAACGGATGACGCCTTCCTCGCCATTTTCATGGTCCTTGTCGCTGTTGTCAGCATCCATATAGCCTCCGGGGTCTACATGAAAATTTGACGTGTCAGCAC
TCTGACAAAAAATAATGTGAGTACAAAGCGTGGATCTAGCATCGTTGATGCAGTCAAACCTGCGTATATGAGGCATGGTTGGTGACCATACAGAACTCTG
ACTCATCACACTTAGTTGCCACACCGTGTGGCTCATATGACGTGTGTGCATACAAGTAGCAGACATACTAAATTCAAGTCAAATGTTTGGTTCCACAAGA
ATTTGCATCTTATAGACGGTGGGGCTCAAATAGCGAGGATCATATAAACAGGTTTGACTGTGTTTATTGCTCTACAATGTACCCCGAAAGAGGTACACTC
CACCCGACCCCCAATTGGAAAGAAAGCGCTGTCCGGCCGACACCACGGGCATGGGCGAGACGGACACGGTGCTGGTACTCATTACCGGAGAGACCAGGGA
CTACATGTACGCGGTCGTGGCCAACCTGGGCA