Description :
From Genome Similarity Track
Location :
Scaffold_66:39115- 40725
Sequence
1610 bases(100 bases per row)
GCTGCTACCGGGTCGACACACACTCGTCGACCCGAATTGCTGAAGATTGACATCTCAAGTACAAAGGAGATGATTAAGACTCTATGTTGAAATAGTTTAT
CGAACTAGATGACGCCATAACCGCTCGTCACATTGTCGATGAGCAAATGCAGGTCGCATTTGCTCAATCAAAATTGGCAGGATGTAACGGGGTGAGCCAC
TTGGTGACGAGGTACCCCTCATCACCTTGAATTTAGAAGTGACAAGAGATTTGTCACTTCGTGCCTTAGTTGACTGTGGGGCGTCGAGCAACTTTGTTCG
TCGCCAGTCGCTAGAGTATCGTAGGCTCAAGTTCGTTGAGCGCATTAATCCTCCTACGAGGCTGACGGTGTGCCTCGCAACAGGCGCATCGATAGCAGTG
ACGAAACATGTGGTGGGATTTCACTACACGTTAGAAGATTTGCCGTACAATGATGATTTCATTGTACTTGATTTAGATGACAAATTTTTGATGTCATCCT
AGGGTTACCCTGGCTCAGAAGGTACAAGCCAAGGGTCAGCTGGCAGCATCTAACCGTGAAGATGCCTGCCACTTGTTCATCAGATGGCCATATGATGAAC
GTCTTGGAGCGTTCACAAGCGTGTGGATGTACTGCGAGTGAGTGCGATGGCCTTACTTGCGGTACGGTCGTTAGTACGACTGCACAAGATTACAGTGTGA
CAACCAATCACACTGTGGAGGAAGCTGCCGGCGTCTGTGCATATGCACAGGCAGCGCCGAAGGTCCATTACTCGAATAAGTCGAGTGGATCGGGACATGG
GTGCACATCTAGCGGGAGACATCCAAGAAAGAATAAACCAGTTGCCCACACAGGGCAACATGATGATCCTAGATCGTCTGGAGAGTCGATCGTAGAGAAC
CTAGCTGTGGTAGTGCAACCACAGCTAGAAGGCGTCGAGGGAATAAGTCCCCACGTACTTGAGGAATAAATCCCTCAAACAGTTATTGGTGAGGTAACGA
GACCTCATCTGCCTGAGGGAATAAGTCCCCATCAGCCTGTGGAAAAGAGTTCCCAGGAAGAAACTGAGACATTGAATGTCTTGGTTAATGACGGCTCAAG
TGTAGGCGCTTGTACACTTGATCTGATCGCGCCTCCGAAGTTGACTTCGGAGATCACTCAATTGCCAACGCTGGAACGGAAACGGTTCTTGCGAGATCTG
CGTAGTGGCAAGATCAAGCAGATTTGTGTACTCGTCACGAAGGATGAGTACGTGACTGACATTCGGTCGGCAGTATTATTTGCAGAGAACGAACAGGTTC
TCAGCGGTTCATCAATGAACGAAAGTGTCCTTGATGAGAAGACTCGGATTGAGAGATACACGTCTCGATCTGCGGAGTCGCTTCAGGCAAATCATTTATA
TAACGATTTGATCGAATTCAAGGACGTGTTCCATGAATCCGGACCATGCGAATTGCCTAAGGATAAAGGCACTCGACATGAAATCGAGCTTAAAGTGGGC
TCGAAGTATTGTGTCATGAAGCAGTGGCAACTGCCTCGTGAACAAGTACTTGCGATCGATAAGTTCTTTGCCGATCGCTTAGCTGCGGGTCATGTGAGGG
AGTCAACTTT