Description :
From Genome Similarity Track
Location :
Scaffold_121:39111- 41122
Sequence
2011 bases(100 bases per row)
AAGAACGCTTCGCGACACAATCATGGGGAGGACTCGCCGCTTCGAATAACCCGGCCCTCGCGCTATACGCGCGAGTTCGCTGATGTCTTTCCTGACAAGA
TCCCAGCTGTTCTACCGGCAGATCGCAGCGTACGGCACGAGATTGATCTCGTGCCCGGATCCAAGTATTGTGTAACTCGACAATGGCCACTTCCACGGGA
TCAAGTTGAAGCGATTGACGCCTCCTTTAAAGGGCGCCAGCAGGCGGGTCATGTGCGTGAAAGCACCTCACCTCATTCCAGCCCTACGTTCTGCGTCAAG
AAAGCGACAGGCGGATCGTCCACGCCTACAACAATCTTCACGACGCGACGATATCAGCCCAGACTCCGATCCCTCGTAAAGACGTGGTTCTCAACACCAT
GTCTGGAAGTACCATCTTTTCTTCGCTGGACCTCACGGACGGCTTTTATCAGAACTTGATGCGTCCTCAAGATGTTCCTCTCACTGCTGTGAGCATGCCT
AGCGGCATGCTATGGAAATGTCTCGTGATGCCGCAGGGACTCAAGAACACCCCTGCTACCTTCAATCGGATGGTGTCGCATGTGCTCCGCTTATTCGCAA
CTTTGCCCCAAGCTACTTTGATGATATCTTCGTACATAGTCGCGCCTCTACCGGCACGACCGACCTCACGGTCCACCTTGGGCACCTTCGACAAGTCTTT
GAAGCGATGCGTGAGAACAAGCTCTACGCCAATTTGAAGAAATGCATCTTTTGTGCACCGGAAATACCGGTGCTTGGTAGCTACGTCAGCGCGAAAGGGG
TTCGCGCTGACCCGGAAAAGATCTCTTCGATCTGTTCATGGCCTGTTCCACAAGAGCAGAAACATCTTTGCCAATGGTTAGGTCTAGCCAACTACATCCA
TCATTACGCCAAGAACTTTGCTGCTGTGACTCACCCATTGTATCAGTTGTTGAAGAAGGACGCCACATGGTCGTGGCGTCAGGAGCACCAAGATGCTTTC
GACGAGATCAAGAGAAGACTTTCTACAGCGCCAGTGTTGGAGCTACCAGATCACTCGAAACCATTTCATGTGGTCTGCGACGCGAGTGATTTCGCTATTG
GATGTGCTCTCATGCAACATGACAGCGAAGGCACTGAACGAGTGATCGGTTATCAGTCGCGCCAATTGAATCCATCTAAACGCAACTATCCTGCGCACGA
CAAGGAGCTGTTGGCTATGAGATATGCACTCGTCAAGTTTTGCGTCTACCTGCTTGGAGAGCAGACGTTCGCACTCTACACCTACCATGTCTCTTTGCGC
ACAGCGACACAGATCCCCCATCTCATCCAGCGCACGGCGCGCTGGCTGTCGTTTTTCGCTGAGTACAACTTCGTTGTCCACTACAAGCCTGGTTCTAGCA
ACATCCTCACCGACGCTTTGTCGCGTCGGCCTGACTATGATCCGCGTTCTACTGTCCCGGTTCCTGTTTCGACCGATGACAATCACGATGAATGCGTTAC
TTGTGTCGCACTCGGTGTGAATGCAACGCGGGTTACTGTGGTGAACCCCCTTCGAGTCGACAACGCGGCAGCTTACACCCACGATGTCTCCTACGCGCCG
ATCGTTCGGTACTGTCGTGATCCATCTGATGTGACGCTGCGCAATCTCACAGCGTCGGCTCGAGCCCAGGTTTCGGGTTACTCACTCAACGGCGACTTAC
TCATGTACCAGATCGATCAGTTTGACCCTCCTCGCATCGTCGTCCCACTCGACGACGATCTACGTGCTCGTGTTCTTCACGAGCACCATGATAGTGCAAC
TAGTGGTCACTTGGGCCGAGAGAAGACCTATCTGTCCCTATCTCGCACGTTCTACTGACCCCACATGTATAAGTGGGTCCGCAAATGGGTACGCTCATGC
GAGGTATATCAGCGCGTCAAACCGAGTCCATCTTTCCAATCCCCATTGTGCTCTCTACCGGTGGCGGCCGAGGCATGGGACTTGGTCAGCATGGACTATA
TCTTTGGTTTT