Description :
From Genome Similarity Track
Location :
Scaffold_889:3911- 6066
Transcript NameFunction/comments
Phymu_g12269hypothetical protein

Sequence
2155 bases(100 bases per row)
ATCCCACCCTCCTATCCATCTGTGCAGCCACCCCGCACAGATCCTCCCCTTTTCGCACCTAGTGCGACGGGCCTCCTcccacttcttcttcttcgtggga
TTGCATGACTCCAAGCCGGCTGCGGTTGACCTGGCTTCTTTCGAACTCGCGGAACAGAGACCTACAATTCAAatccacctcgtccacccACGTAGGATCG
TCGTACCCCTTCCAGTGGACCAAGAACTCGCGACAGTTTCGCCCATACCGCGTCTTCCGGGACGATCGTACGTCCGCTATACGCTCCACTTCAtactcgt
cttcgtctaACACTCGTTCCCAGGTGTCTTCAGGTAAGAACGCTTCGTCAAAGTCcacgcgttcttcgtcggGGACGACGATCTCAAGCTTCGGACGGTC
CGGGAACTGCCTCACGggcttgagcttcgacaCGTGTACGATCGGGAAGATCCGATACTCAGTCCTCGCGAACTCTGGCTTTGCTGCGTGCTTGTCGATC
ATCTCTGCCACCCGGAACGGACCATGCCAGAGGTGCGCAAGCTCCCGCGCGTAGCCAACCTTAACACGGTCCAGGTACAGCCTGACCTGATCTCCGGCCC
CAATGGAATGTggacgaagatcttcgtcgtcgtgaTCGGCTCGTTCTCGGATAGCTTCGCGTAGACGTTCGTTCACCTCCTAACGGGCACGTTGGTAGTG
ACGCTGCACATGGCCACGCCATCTCCGGGGATCGCGGTCCCTGTGGCGCGTGTTCCCCACAGGCAATGTGGCTTCCAAGGTCGATCGTGGATCCCAACCA
TGAACCAGGGAGAACGGAGTGTCGCCGCGAACTCGATCTTGGGCCGTGTTCAGCGCGAATGTTAATCGATCCGCGTATTCGTCCCAGTCCTTCTGGTTCA
CGTCGGCGACGTATATCTTAACTGAGCGAGTCAGCGTCTGAACCATCCGCTCTGCTGTCCCGTTCGCCTGCGGCCGGTATGCCATCGTCGGACTCTGTCG
TTGACCCACAATGCGATTAAACGCGCGGAAGACATCTGTCATCAACCCGGGCTCGCGATCATGTCGAATGACTTCGCTCGCTCCCAAACGACGGAAGACG
CATTCCTCATAGCTCTCGGCGATCTGTTGCGCGGTCCGGGCGCCGCTTGCTACCGCCAGCACGTACCCGGTGAACAGATCCACCCAAATAAGAAGCTCCG
TGTTTCCCTTGTGCGACGTCTACAGCGAGGGGATATGGTCCATGGCGATTATCTGGAACGGGTAGGTGGCCTGCAAGTTACCGGGCGATCTTCCCTGAAT
GGTAGGCCTTCCTTTCCCGGTCTCACAATCCACACACTCACCAACGTATCGTTGCACGTCTCGGAACAGGCTCCTCCAGTGAAAGTGTTGCTTGATCCTC
GCATACGTTCTTCCGATTCCTTGGTGCCCACCTTCCAATCTTGCATGATAGTGATGCAGGAAATCTTGGCGAAGCCGTTCTGGGAGCACCAGCTTGGCGA
TCGCGCCACGATCTTCATCGGCCTTAGACGAGGAGGCTGGGCAATACAGCAGGAGcccgtcgtcgtccacttcaTACGAATCGGCGATCTTCCCACAAGA
CCGAGCGTCCTTTGCCGCCAGATCCGCCACGTCTCCTGTCAGGTCCGTCTTCAGATCGGCGACCCACTTCTCTTCAGCTTGTGCTTTAGCGATGCATTCT
AACCTCATGTTCTGTACCACTGGTTCTTGCAGGTATTCCGGTGACGCTCGCCGTCGCGCGGAAGAACGGGTTACTGCAGATACTCGgaccacgtcttcgt
cgttctTCGGCTTCAGGATCTCCCCAAGCCGGTTGAGTGTGACCAAGTCATCCAAGATCTCCGCTGACGTTACGACCGTTCCCGCTTCCGTCTGCAAGGC
TTCGCCGGCAAGGCGATCTGCGCTCTTGTTCCAGTCCCGCTTCACGTGCACGAACTCGTGCTGTGACTATGACGAGAGTCTCCCCATCGCTTTCTCACGT
AGGACCTGCAGCGCAGGTGCCTTGCATGCGATCTCCCCACGCATCTGCCGGATCACCAAGTTAGAATCTCCGTAGAATACCAAGCGTCCCCGGTCAAGAG
GTTCCAGGAGATCCAGACACAGGATCAGTCCATGATATTCGGCTTCGTTCACAGT