Description :
From Genome Similarity Track
Location :
Scaffold_939:3911- 5648
Sequence
1737 bases(100 bases per row)
ATGTATTCTATTTGTAGCTAatccaccaagaagaaggcacaACTGCGACTAGATGTCGTGTTTCTAATGGTAGACCCCGCCTCAAAAAAATGAGGCTCCT
TGTTGTTTACCAGCTCGAGAGCACATTAATCTCGAGCCAAATTTGCATGAAATAGGAAAAGGCGGTTTTCTTAGCCCACAGGCCTTGTCAGCCGGTTCCC
TACCGTCTATAGACTAGGCTAAAATAGGCTCTCTGAAGCTCTTTCCCATCACACTTTTCTTCCCCTAAACACAAATAGTACCGTGATTGTCAGTCAAAAG
TTTGGTACTCTATGCACCTGTACCACCGTTGTGGTACAGGTCGGAGAGGTCATCCGGTCTGATATGTTTTGGTATGGATGTTTATCTAACATGTTTGTAG
CGAGTTGTTTCTTGTTTCATATCACCGGTTGGATGCGTTTGGTATATGTTTTAGCAGACCGATATGCATAACGAGAATATACAGAATTAATAATGATGTT
GCTTGCCCTATTCAGTAGTTTCTCGATTAAAGGCTTTCATTCCGAATAATACTAGTGCACATAAGTAATAGGAAGGGCCTACGTTCACCAACTATTTGTT
ACGAGAAAGGAACGCAACCATATTCCCTAAATTTGCACCAAATTCGCCGAAGACAGGCGGGACCAAGCGCAGCCTGCAGCGCTGTAAGACTAGGGTCAAA
CGTTCGGCTTTAGTCGAGAAAGGTTAGTATCGACGTTTGAggcgaagtcttcgcgcgATGTCCTATACCTTGACATTGCCGTTTCCCGCTTAGGTTTTTC
AGGGTTAGGGTCAAGGAGTAAATCTGCCGGCAAGTTGCTCGAGCGTCCATTCTTTGAACAAATAGTTGGTAAACGTAGGGATGGCCTAAGAAATAATCGA
TCGCATTTGCTCTCCTGTTacaacagcttcagctcttgACGTTCAAGCGCACGGACTTCCACGCCGCCATTTAACGTCGTGCCAACCTTGCACGGATGTT
CAGGTGACCGAATTGTTGTCACGAGCCACGCCCTAGCCGTATGTCTAGAGCCTCCGCCACCGATCATCTTGGTCACGACCCTGGACGAGCTACTctctcc
ccccccccatccCCCTCCACCCTCCTTGCTCGCTGCGCACAATTTCCCTTTGGTTATCCCAGTTGACTACGTTCTCGAACGTGACATCGGCCTTCACCAT
GGACACGCCCTCCTTTTCGCCGCCGTCGATCACGCGGTAATGCTTGAGACCGAGCTTCCCCcgtacccccccccctccacttgctcgctGTGCACGTCTA
CTTTTCACCCCCTCCACTGCTGTCGATCACCGTCGCTACGCTGCCGGCCGATCTGCCCTCCCACGAAACAGGCAAAAGAAGATATAGACGCACATTTGGT
AACCATATTTTGCCGATTTTAAACCGGGTTTTTATTTTTGACGTCTCGTCTCTTAGGTCCGAAGGTCTGATAAATTTTGGTGGAGTTTGTACTGCAGGTG
AGTGATGGTCGGGGTGTTGACTAATGGTTCTCATTATATATTATAGCAATTGTATGAGAAGAAGGTCGAATTTCACCGACGAGAAGCGAAGAAGGATCAA
GGGCCTCGCGGAAGCGAAAGCAGGCACCGCTGGACGCGAAATCTCGGAGAGTCTACAGTTCCCACAGGGGTAACTAACGTGCTAAAGGAGGAGAACACGG
AGTAAAAAAAGCGTCGGCGGTCATGTTGTCAGTTATC