Description :
From Genome Similarity Track
Location :
Scaffold_30:391072- 413804
Transcript NameFunction/comments
Physo_134197respiratory burst oxidase-like protein E
Physo_134198hypothetical protein
Physo_156878hypothetical protein
Physo_108765predicted protein
Physo_134201hypothetical protein
Physo_156880Unknown (protein for IMAGE:7547409)
Physo_156881cell division protein FtsZ
Physo_134203hypothetical protein
Physo_134204hypothetical protein

Sequence
22732 bases(100 bases per row)
CGCCTTTGCAAGGACACGAGGCGCCTCGGCGGACGCTAATGGACCGCCAGAACCGCGGCCAGGTGGAGGGCGGCGCTGCCGCGCGCCAGCCAGCCGACGA
GCTCAAGATCACGCCCGGCCAGAACCTGCAGCCGTTCGTCGACATCTCCACGCCCTCGCCGCACGCCCGCCAGTTCCAGCACAAGCCCAACAGCAAGTCT
TCCAATAGCAGGTCAGGCAGCAGGAGCAATAGCAGAGTTAACGGCAGGTCCAATGGCAGGTCCAACAGCAAGAGGGGCAGCATGAAGGACAAGCGCGTGC
CAGGACCGCCTCCGCCCCCGCCCCCGCCGTCGTTCGGACACCCGTCCATCGGCAGCAGCCACCCGAGCATGGTCTCCTCGTTCCGGAGCACCGCCAAATC
CAACTTCATGGATAGCAGCCAGTTCATTAACCCGAGCGCCACGAACACACACATCATCGGGTGCGGCCCGCCCAAGATGAGCGCCAACTGCAAGAGCAGC
CGCGGCCCCCGCCGCCGACCCAACGTCCAGGCCATGCTGGGCGCCTCCATGGTGCGCCAGAGTCTAGCGCGCGCGTCCAATCTGTCCTCATTCGCTGGAT
CCCGGTACGGCCCGCAGCCCGGCTCCGACGTCGTGTCGGTGCCGGTCTTGGGCGACTGCAACTTCGAGCAGAAGTACACCGTCGCAATGAGCATGGATGA
GCATGCGATGCACGCCAACGACCCGTCGTACACCCCCATGGAGAAGCTGCACGCACTCCGCGATGTTATGAGCAGCATCACCAGCAAGGGCGGGTACATC
GAGCGCGAGACGTTTTCGCAGACCTTCGAACTGAATGGCGACGATTTCGATGGATACGCCACGGGCAATGGAGCGATCGACGGTAACGCCATCCTAATCG
ACGCCGTTATGGACCTCAATGTGGATGGCGAGGAGAAACTCCGCTTCATCTTTGAAACACTCGACCCGGACAACTCGGGCTACGTGATCGAAGACCAGAT
CGTCCAGCTTCTCGAGTCAAACTTCTCCGCCGCTCACCTAGACGTGGTTGGCACGGACTTCAAGACGGTGGCCAAGCTCATGTTCCGCAAGGCCCAAGTA
AAGAATGAGTCCATGACGTACGAACAGTTCAAGACGGTGTTCGCCCCGTACATCAACGACTCGTACAACCTCCGCAAGTCAGCACCCGTTTACACGGCGC
CTATCCGCCCCAAGAGCAAGTTCGGCGCCTGGTACAGCGCCAACAAGCTGCGTATCTGGTGGCTTTTGTTCTACGCCATTCTCAACAACATCGCCTTCTG
GGTCAAGTGGTTCTCTTACGACGTTGACCCCGCTATCGGTTGGGGACTTCGCATCGCCCGTGCAAACGCCCAAGTTGCCATGGTCAACTGCGTGTTCGTG
CTGCTGCCCATGTGTCGCTCCATCACGCAGGTGATGAAGCGCAGCCGCATCCTTTGGCGCTACATCCCGTTCGACGACAGCATCGCGTTCCACAAGATTG
CGGGTAGCGTTCTCCTGACCGCTGGCCTCATTCACACGATCGCCCACGTCTTCAACGAGATCTACCTGTACCTGGTTGCCACCCCGGAAGAGATCAAGCG
CTCGATCTTCGTGACCCGTCACGTGTCTTCCTTCGTGAACGGCGAACGCCCTCCGTTCATAACGATGTTGCAGTCACTTCCAGTGTGGACGGGTGTGATT
CTTCTGGTGATCACGTGCATCTCGTTCCCGCTTGCTGCCATCCCCAAGTTCCGCCAGGGCAAGTTCAACGTCTTCTGGTACTCGCACATGCTCTTCGGAC
CGTTCCTCCTCGTGTTATGCTTTCACGGTGCCTGCTCGTGGCTCGCTCGCAGCTCTTCCTACATCTGGATCACGCCTCCGTTCTTGATCTACTTGATCGA
GCGTCGATTCCGCTACGCCAAGATGTTTGCTGCACCTGTGCGCATCATGGAGGCCATGGAGCTGGACGGCACGGTCGCGCTGTTCATGGAGAAGCCTCGT
CGTTTCGTGTACCGCCCGGGCATGTACATGTTCGTCAACTGCCCGCTCATCTCGTCTCATGAGTGGCACCCGTTCACGATTTCGTCGGCCCCCGGCGACA
ACTACATCAGCGTTCACATTCGTGTGTGCGGTGACTGGACGCAAGCTTTGGCTCGGGTGATCGCTGATTGCCATGAGCGTAAGGTGCTGTACCCGGATAT
CCACCTCGATGGCCCTGTCGGTGCCCCAACCCAAGACTACCACCGCTACAAGACGGTCATCTGCGTCGGCGGTGGTATCGGTGTTACTCCGTTCGCTTCG
ATTCTGAAGGATGTCGTTCACCTGTGGGAGGCCAACCGCTGCCCGAATTGCAGTCACGTTCGCCACCCAGGCTCGTTCAAGATCCAGAAGCTCTACTTCC
ACTGGGTGACCCGCGGACAGGAATCGCTGAGCTGGTTTGAAGAAACGATGAACCAGATCGCCGAAATGGACCGCGACAATGTGATCGAGACGCACCAGTA
CTTGAGTACCTTGAAGGGAAGCGAGAACACCTCGCAGCTCAAGATGTTCCAGGAGTTCGTGCACGAGCAGACTGGCAAGGATTTCGTGTCGGGTCTCAGC
ACCAAGCAGCTGACCCATTTCGGCCGCCCGGACTGGGACAAGGTCTTCTCCGAGGCCAAGGCCAACCACCCTGGCGAGGAAGTCGGTGTGTTCTACTGCG
GCCCCCACGCCCTCGAGGAGATTCTCGACAACACGTGCAAGAGGTATTCGTCCTCGGACCCCAACGGCACGATTTTTGACTTCCACTCGGAGAAATTCTC
ATAGACTACATGTATACGTCGTTAGTGTGCCGGTTTGAAGGCAGCTCCTATTCAGACACGTTGATAACCGTAAATTTGAAGTGTTAAATTGTCCTTGCTG
CACCGGAAAAGTTTAGACGAAACCGGAGATCAGACGCACGATGTACAGCGCAAAAGTATTTACCCCCAGAATGACACCAAGAGAGTACGAGATTTTACGT
TATCTTTTGAGGTGTTAAACGCGCCTGTGGCTCCGCATTGTCAAAGCGGATTAGAAACTCAAATGTCCAAGAAGCTGCTCGTTGTTGGCGGCGCCGGTGC
GCTAGGCCGCGGTGTGGTGAAACACTTCGCCCGTGCGTCTTGGGGCGTCACGTCCGTGGGATTCTCGGCCAACGAGGACGCCGAGAACAACGTGCTGCTG
CCTGTAAGCAACTCGCTCAAGCAGGCGGAGCAAACGCTGCAGGAGATCTCCAGCAGGTCCGTTCACCCTCTCACGTGCAGCCACTCTATTGTAGTACTCG
ACACTTACTTAAAGTGGGCAGGAATGGCAAGATGAACACCGTCGTGTGCACTGCTGGCGGCTGGGCTGGCGGCAGCATCCGCGACGCGGACTCTCTTCTG
AACTTGAGCGACATGCACACCAAGAACTTGGAGTCGGCCTTCCTGGGTAGGTTGGACGCAGGGCATTCAAGTGGTTTGCGCGGTTTCTAACAGACCTTTG
CGACTCTGTAGCAACGTACTTGGCCAGCCATTTGCTGGTACCCGGTGGCCTGCTAGTGCTGACGGGAGCGACCGCTGCTCTCAAGGCTACGCCTGGCATG
GTGTCGTACGGAGCAAGCAAGGCGGCCACCCACCATCTGATCGCCAGCGCTGTGTATGATCATCAAGTGTTGCAGTGTTGGTGGACTTATGGCACGCTAA
TGATAATTTTTCGGTTAACATGTGCAGGTCTGAGCTTCCGGACGATTCGTCCGTGCTGGGCGTGCTTCCGCTGACGATCGATACGCCGATGAACCGCAAG
TTCATGGCCGATGCGGACTTCTCTACCTGGACCAAGGTAACCAGAGATGCGTGCGTATTTTTTTTAGTGTTTGAAGTCACACGGATGCTTGTGTTTAATG
CACAGGCGGAGGACATTGGCGAGAAGATTTTGGAGTGGTCTGACGCCCCTTACGCTGCTCGCCCTTCGAGTGGACATTTGATCACTGCCACCACGGAGAA
CAACACAACGACGTGGAAAGACGTTGGCAACCCGTTTCAGTAGATACGATCAGCTGGCAAGGTCAAGCGTGAAGAGGAGATAGTTTTTTGCATCGTATCC
CTAAAAAATATCTGCTCGCGTGCTCGCGTTATGCTTTTACCACCCGATGCATTTTGTTCGCGCTGGTCTCGATATTGGCATCGCCGATTACAACGGCATT
GCATCCCCGTTCACACTAACCGTAAGGTTGCGCTTGAAGTGGTCGCAAAACGCGTTTAGCACACGCTTAAACTTGCGCGAGTTTTCCACACAAGTCGGTG
TGGAGATGTAATTAAGGAACTCGGCTCGAGCACGCTCGCTGACCTGCGACCCCAAAAAGTTGCTGTCGGATAGGAGCCGATGGATCAGCTCTTCACTTCT
CTGCCGGCCAAAGTACACCCAGCATGACCGAACGACCTCCGCGATCTTGTCCATCAAGTTCGGCGACATGCCCCCTGCAGCGGCGTTGAAGAGTGCGAAG
AGGACGTGGTATTGCACGTCCTTCTCGAAGAACAGCGTTTGGATCTGCTGGTGAAGTAGGAGTTTCCCGGCAAACTCGGGTCCCTGCAGTAAAGCTTCCG
GGGTGCGCAGGATTTGACCGTAGAGCGACCCCAACTCGAGCAGAAAGTCGAGTGTTGCGGCTCCAACTTCGGGGTTCTGCGACTTGAAAGCGTGTAGCGC
TAATGCCAGCACACCCTCCAACTGATTCGACTGTACTAGAATTGACGGGTGGTGCGTGCCGCACGTGGCCACCAGAGAAAACAACGCGGCCGTCAATCCA
GGGTGCTCATCAACACTGCCGTCTGCCGCAATTTTGCTCATGGAGCTTTCGCTGACAATCACCATCACGCGCGTTAAGCTCACTGCTGTAGCCTCGTCAT
CACCAGCACACCCGATGATACTTTTGATCACGCTTAGATAGCTACCGTCATGGCTCCGCGAGAATTGTTCCAGCAATACTGGCATGATTGCGGATGCCAG
TTCCAAAGCTTGAGATCGCAATGATTCAAAAACACCTACTAGCAGCGCACAAAATGGTTCAATGACCTCCTCGCAGCAGCCGTACACGCTCAAAATGGTC
GCCAACACCTCCCACTGCTTCTGCAACACGCACAGCACTGGATGCGGGACCTCTTGGTCCATCTGGAGAGGAATCCGTGTGGCCAACACGAGGAGATGGT
TGAACATTTCGCACAGGAACTCGATGGAGCCTTCGTCGTCAGGATTTAGTTGGCTGTAGCGCGAAGCAAGGTCCGAGAACATGATCGTTCCAAGCTCCTC
CACTACAGGAAGTGCATCCTTGTACGACACCGTCGTGAGAACATGGCAGATCGAGTCGACAATAAGCTTCGCGCTATTCCCCGTCAAGCATGGCGGCGAC
GGTCCCCCTACTGCAGCGCGGTTCGAGCGGTACAGGTTCACCAGTGCGTCCATCCACAGCGGATTGAAGAAGTGCGAGCCACAGCGAAGCGTCAGTTTGC
GGAGGGCAACAGCACCCACGTGATCTTCTAGACCATGTTGACTAAAAGGGATACCAGAACCGTCCTCGGAGAGCTCGAAGCCATTCGACACAATTTGGAA
AGCGTATGTCCCCAAGTACTTTGGATGGCGGGCAAACCAATGACCGGCTACACCAAGGAAGATGGTGACTGTGCGCGAGAGCGCGCGGTGCGAGGGCTCT
TTTCGCGACAAACATTCGAACAGCCTTGGAACGAGCGACGTGTCTTCTTCACGAATCGATTTTGACAGCGCGCTTAATGCGTGCACATACACTTCCGTGC
GTCGCCACCACTGCGGAAAAACACAATAAATTAGTTAGTTCGCTACACAACATACTACCTACACAGAAAACATTTCAAGAGGATACGTACATCCGGCGGC
AAAGGCGCTCCCGACTCGGCGGCTTCGTACTGTTGGAAGATCGCATGAATAGCATCTACAATGAACTTGTCCTCACTAGCGACCGTGACAGTGGCAAGGG
CTCGGAACACATTGCGCACTTCGCTTCGGTACAGGAAGAAAAGCTCCTTCGCTGCTTCTGGAAAGGCTTCAAAACCCTCGGGATACTGCGTTCGCTCTAT
CAGGATGACCAGCAACCGCGAGATGAACGTTTCAAACACGTACATGCGTTGCTCGTGCTTTCCAGATATGTACGTGCGGAAATTAATCCAAAACTCCATC
GTCTCGTTCGAGATGTCCAGGTTGTTCAACGACGTGAAGTAGAGAATAGTGTCCAAAAATTCGTAAACGAGAGACCCGGGACGCATGTCGAGCGTGTAGT
CAACAAAATAGACGATGAACGCTTGTCCGCACTCCGATATCGCTCTCGCGCAGTCAGCAAGACAAAAGTCCATACTTTTCGCTGACGCAGCCATGCGCTC
CTGGAGGTGCTTTCCTAGCATCACAAAGTTGTGCATCACCATTTCCATGAGCTGCACGTGCTCATCATGGCGACAGGCGCGAACAACTTCGCGTACAACC
TGCAGGGCATACACCGAAGCAGCTGGAACCAACGACTCACGGAACGCGCGATCCAGCATCCCGCATTCGATAATAACTGCTGGCAATACCGTTCCATGCT
CCACCCAGCTCGCAAAAGCTTGCAACAACAGGCCCCGCAACTGCACTTGGTCTTCACTCGCATCAATAGCTGTAGCGATCGACGGCAGCACACTCCGGAC
CACGTGTGCGGCACACTGTTGAACCATGTCTTCGCATTGAGCACGTTTCACCTTTGTAAACTTGACTCGCTTGTTGTCAACCTCCTCTGGGATGACCTTC
AGCGTCAGCAGCACTGCAAAATTAGTTAGCGCAGCCGTCACGTTGTCACTCACCGGGTGCTGCTGGTTCTGCACGAGCCACTCCACTGCTCCGACGACTG
TGCTGTCGCCCTGCGGCTCGTGGAAGCGCAGCAGGATGACAGCGATCGTCAGCGCCAAGTGGGTTTGCACGTTCAGTTCCTCGTGGGTTCCGTTCGGCCC
CGTCAGCACATTCCACACATCTTGAGCCATCTGCCCGAAGTCCTTCACCAGCACCTCGTGCTGAGCACGATCTTCCGGTGTCCAGTTGGCCGGGTCGTCC
ATCTTGTACTTGCGAATGTACGAGGCCACCGTGAAGTAGATCGTCGACGCAGCAAACGCGCGCTTGGCTCGCAGCAACGCATTGTGCTCGGCGTTCCCCG
TGTCAACAATAGGCGCCTGCAGCACGCCCAGCGCGGTCTGCGCAGCCTCGGGCGAGCGCTGGAACTGCTGCAGCAGTGAGTCAGCACGACGACGCACCCG
CGGCGAGCTCAGCGGGCTGTAGAGCTGGTGCAACGCCTCGGACACGACGGCTTCTGAGACCACCGCCACCTCCATAGCTTCTGGGGTTGTAGAGGTTGTG
CCGGAAGGAAGCAGTGTCGTCACGCTTGGGGTCTTTTCCGTCAGTTGGCGCTGGTTTTCGCGACTGCGAGGTCAGAGCCTTCTTAGCACAGCCAGCAGAC
CGATAACAATAGACAGCGAGCGAGCGAACGGTAGATCCAATCAGAGCGAGGATGACCGCAGGCTAATTGCGGCAGTGTGCGCCAGGCTGAAGGAAGCAGC
GCGGCGGGTTGGGTGGGTCTCGCGGCCGGAATTCGGGCCGACCCGTCTCTTTTCTCAGCAGGCTAGAAAGATCGATTCTGCGCGCAGGCCTCTTGAGAGC
GCGGTCGCGGCAGTGGCGGACTGGTGCAGCAGCTTCAACTGCAGCAGGAGGGGCTGCCTTCTTCGCCTTTTGCGGTAACTCCGTGGAGGAGGGGTCCAGT
AGATAACGGAAATGAGAGGGTTTCGTCCGTGATGATTGGTGTGGTGCACATGAGCTAGGTGGCACTTGCTGATTCACTGTTTTTGTCTAATACCGTCGCT
TAACACGCCGTCATTGGCCGAAAAAGGTGCGATGGCAGCTCTCCCACTATCTTATGCTGTTTCGCAGACCCTGCCTTCCGTTCAGCTATTGGTTTTCAGG
GGTATGCCTTCTTGCGACGGCTTCGTGGCAGCTCAACTCCAGCGCACTCCCTCATCCGCCCACGAAACCGCGAAGAAGCCAGCGGCGAACAAACAGCGGA
GCGGCAGATAATTGACCACCTCCCCCCTCCCCCCTTCCCTTCCTCTCCCCTCCCAATCCGAGCTACGATGTGGATGAAGTGCGTGGCGGCGACGGCGCTG
GCCGCGCTGCTGGCGGTGCAGGAGGCCAGCGCGGCCTTCTACGTGCCGGGCGTGGCGCCCGAGTCGTGGGCCGCGGGTGAGACCGTGCGCCTCAACGTGA
ACAAGATCACGTCCACCAAGACGCTGGTGCCGTACGAGTACTACTACCTGCCGTTCTGCAAGCCCACGGCCACCAACGAGCAGCAGGAGAACCTGGGCGA
AATCATGGCCGGCGACGCCATCATGGACTCGCTGTACAACATGCAGATGGAGAAGGACGCCATCTGCCAGGTGCTGTGCAAGCCCATGACGTACACGTCC
GAGCAGTCGCAGTCCTTCATCGACATGATCAAGGACGAGTACTACGTGCAGTGGGTGGTGGACAACCTGCCCGTGCTGTACCGCGACCCGACGGACTCGC
AGCAGGCCGGATCTTTCAAGCGCGGCTTCCCCGTGGGCGAGGTGGACGAGGACGGCAAGTACCTGCTGTACAACCACGTGCGCATCATCATCTCGGTCAA
CGCGGACCCGTACGCCGAGGAGGACGGCGACGTGCCCAAGTGGCGCGTCGTCGGCTTCGAAGTCGTGCCCACCTCCATCAAGCACAGGTACGAGAACGAG
CCCATGGCCGGCCAGGAGCTCGACTCGGACACATGCGGCAAGTTCGTCAACATTGAGGAGGTGTCGCAGGGTAACTACCAGTACCTGAACCCGGAGGGCG
AGACTACCGTGCTCTACACGTACGACGTGCAGTTCGTCAAGTCGGACATCGTCTGGGAGGAGCGTTGGGACCGTATTATCAGCAGCAAGAGCTCGAACGA
CCAGATCCACTGGTTTTCCATCATCAACTCGCTCATGATCGTGCTGTTCCTGACGGGTATGATCGCTATGATTATGCTGCGCACGCTGCATCGCGATATC
GCCCGGTACAACGAGGTGCAGACAACGGAGGAGGCGCAGGAGGAGTCTGGCTGGAAGCTTGTTCACGGTGATGTGTTCCGCCCGCCTCAGCTCTCGCCTA
TGCTGTTCTCGGTGGTTGTGGGCACCGGTGTCCAGGTGTGCTGCATGAGCGCGTCTACGATGGTTATTGCGCTGCTGGGTCTGCTGTCTCCGGCCAACCG
TGGTTCGCTGCTGACGACGCTGCTGCTGCTTTTCGTGTTCATGGGAAGCTTTGCTGGCTACCACTCCTCGCGCACGTACAAGATGTTCAACGGCAAGGAC
TGGAAGAAGAACACGATTCTCACGGCCGTGCTGTACCCGGGTCTGCTGTTCGCGGTTTTCTTCCTGCTGAACCTCGTGCTGTGGGGCAAGTCGTCGTCGC
AGGCTGTTCCTTTCGGCACTCTTTTTGCGCTTCTGGTGCTGTGGTTCGGTATTTCGGTGCCACTCGTGTTCCTCGGCAGCTACTTTGGATTCAAGGCCGC
TGCAATTGAGCAGCCTGTGCGCACGAACCAGATTGCCCGTCAGATCCCGGAGCAAGTGTGGTACCTTTCCTCGCCTTTCAGCATCCTGGTGGGCGGCATT
CTGCCTTTCGGCGCCGTGTTCATTGAGCTGTTCTTCATTATGTCGGCGCTGTGGTTGCACCAGATCTACTACGTGTTCGGCTTCCTGTTCATCGTGCTGC
TGATCTTGGTGGCTACTTGCGCCGAGGTGACTGTCGTGATGTGCTACTTTCAGCTGTGCGCAGAGGACTACCGTTGGTGGTGGCGTTCGTTCCTCACCTC
GGGCTCCGCGGCTGTGTACCTGTTCCTGTACTCGTTCCTGTACTTCTTCACGAAGCTGAACATCACGGCGTTTGTTTCGGGCATTCTGTACTTCGGTTAC
ATGTTCCTGATCTCGGTCACGTTTTTCTTCCTGACGGGAACCATTGGCTACTTCGCTTGCCTCTGGTTCACTCGCACGATCTACAGCTCCATTAAGATCG
ACTAAGTAGTCATCAAGTTAGCATTTCAAGGCTCCAGTCATCAGATGGCAGTGAGACGCGAAGAAGAAATAGGAGGAAGTGACGGCGACCCAAAGCGGCG
AAGATGAAGATGTTGTCCTGGATTGCCGATAGGTGGGGTCACCATGAGGGCGAGTGGCAGCCCCATTCGAGCCGTGCATGTGCTGTTTGCTGCCTCCTGC
AATGTGTAGAAGACAGAAAACCTGAGGGCGAAAAGAAAAATAAACTTCATTTCGTTTTCAATTACCAGCACTCGAGACCGATGTCTTGCTTACAGCGTGC
GCCATTCCGCCAGCCATGGATGCTTGTTCACCAAACGTTGCGCACGCGCTTGCCAGACGCTGACAGTATCGAGAGAAACAGGGGCAGTCTTGCCAGCAGC
CTCCAGGATCAAGTCGCTGGGGGTTGCTATCAGATCGGCAGGTGTGCCAAGCTTCTGAACCTCGAGACACTGCACCCCTTCGACATCACCAACAAGTTCC
AACATCCAGTCGTTCACTTCATCGAGACGTGCCTAGGAACAATAAACACGATTAGCCAAATCGTCACTTGTCAACGCATTATTAGTTCACTCACCTCATC
GATCAGCTTTTCAAGCTTAGCTTGCATTGTCGGGGCGGAGGGGTCCAGCGGGTTCACCAAAGCATGCATCGTGGACCCAATGGAGGCGTCCGCCAGCTCC
TGCCGAGTGTTAATGCTAGCCTTTTGCAGCCATTGGGCAATCGGAGCGCCTGTGATCTGGGCGACTTCGTCATCGATAGCATCGCATCCACCACTTCGTC
CAGTCTTTCCCAAGTTGGCGCAAGTCCAAGGATCCTTATCAAGCTCGGCATGACTGGCTTCTTCTGCCGAAAGAATGCGCGCTTTCTTGCAAGTATCACA
GTAAACCGTTGTGGCTTCTTCGAGTTCCTCTTCCGACTCCGTTTCCACGCCGTCGACTGTGGTCGAAATTGCCGTAGTCTGCGCGGGATGCCTATCATCC
TTGAGAAAAGCGGATACAACAGCACTCGTCTGCGAACTTCGGTCGAACCGAGCTAGTGCAGCCTGCGCTGCTGCAGTGCGCAGAGTTTTGGGGGTCGCTT
CTTTGGCTGATAGAGCAGGAGTCTGGCTTACTGGTTCACGTTTTGGCTCAGCATAATTTGGCTCGACTGCTTCTTCTTCGCTCAAGTCCACGTGAATAAC
TTCAGGTTTCTTCTCCTTGGCGGCAGAGCGTTTTGTTGTCTTCGGCTCCGGCTTACTCTCTGCGCGCCGAGGTGATGTACGACTGCCTCCAGCACCTCCC
TGTTTCCACAGCTTGTACTGTTCCTCATTTGCCTGTACAGCACACAGATTACCATTAGGCAATGTAACAGGCTAGAGTGATGAATAAAAACGAGCGAAAA
CGCACCTTTGCTTCCATAGCTTTTTCAGACATCACCCTATGGGAAGCCCCATCACGCCGCATCACACAATACGTTAATACGGATTTCCAAGTATTCGTGC
GATAAGCAAGCTTACCTTGTTCGAGTGTCCAAAAACGACCAGTCTTCATCGGGCACAAGGTCTGCCAAACCAGCAGCCACATCTCCATCGTACAAGCGCG
CGATACTCCAGAAGACCCTCGTGGATACCTGGGCCATGTTAAAAGGCTTGAGCATTTCACGCCCGGTCTCGCCACCAGACAGCAATACATATTTCAAAAT
GGCCTGCAGCTCGTCAGTTTTCAGTAGATCAACTGTCTCCTCCTTCCACTTGCGTGGCGTCTCCTTGAAGCGCACGCGAAGTTTAGCAGCACTACCGTCA
GCGCGCCGGGTAGTCGATTGCTCTTCAATCTCGTAATTGTGCGAAAGCGCCGCATTTAGTCGAGCAGTGGCCAGTGTCAGCTCATATTGATGCTCCACTG
CATTCTTTGTCGCCGCACGGAAGAACTTCGCTGCCCGGCCTTTAGATTGACCGCTCACGGCATTCACCAGGCTGATCTCGACGTCCTCCTTGGAAGTGAG
GTTGATCGCGCGACTGCGGCGGTATTTACGCTGTGGCTCCTGCTCCTCGTCACCAGCTTCAATTCCATCTGCAGCCTCTGGCGGCTTACTCTCCAGCGAG
CTGCCCAGTTGGCGCCCGTTGCCTGTGATTTTCCGTTTTGGCGGCGCCTTCTTCTTCGTGGTGGTGGCCGGCGGGTTAAGCGTATGCACGCCCCCTCTCG
GGGCCTTCGCGGCTGGTTTCTTTGCCGCAGCTCGCTTCGGTCTCGCAGGAGCTTTCTTGGTGGTGGGTGCAGCAGCCTGCACCGGAGCTGCCGCACCCGA
GTTCGTGTCGACCACCACAGTGTCATTGGCCTCGAACACGTACTTGACGAGCGCAGAGCCGTCCGCCTCCACCGCGCGGGGCGGGAACCCTCTGCGAACT
GCAATTACGTTGCAAAATATTGGGGCGAATCAGAGTTATCACTGCGTTGTGCAGTTAGTGGCAGGAACGTACAGGTGGGCGAATCCGTAGCTTTCAGACC
CAATTCCTCGGCCGTAAGCTCTGCAAAAGCGTTTGGCGGTCAGATACAAGCAGCGAGTAGATGGATCACTGAGACTACGAACCGGAGAAGGTCTTGAAGG
TCGCGTCCGGGTCGATTTTGAGCACCACTTGCTTGCCGCCAGGCCCGCGCAGACGCACGCTCCACATGGCCATTGCACCGTTGGCTTTTGCTCGGATAGT
GAGCTCCTGATCGAATATTCTGGGAACGGTCGCTCCGGCGAAATTCTCCGCAGCAACCCACCAATCACTGAGCTTCGTTGTTTGACGTTCTTGTCATTTT
CCAACTTGCCTTTTCAAAGAACGATGGCAGACTCGAGCTGGCAGGAGGCGCTGGCGAGCGAGACGGACGCCGCCAAGAAGGAGTGGATGGCGCTGGAGCG
CCGCTACCACCTGCAGCTGGCGAGTGAGGACGCTGCTACGCAAGACAAGCTCGTGCGGCTCTTCTTGAGTCTGTCGGATCCGGAGCTTCCTGCGCGACTG
AAAGGCCAAGTGGAGCTGGTGATGACCCTGCCTGGAAAGTACCCGGCGGAGGTTGCTCGGGTGGATTTTGCTCAGTGGAGCAGCCGACTGTCGAGCGAGC
AGGTGGAAGCGCTGAATGCTGCAGTGAGCGCTCGCGCGAGACAACTGTGCGGAGGTTTCTCGCTGCGGAAGCTGCTGACGTGGGTGGATAACAACTTCTG
GAGGATTATTGAACCATTCGAGATCAAAGAGGAAAAGGAGCGAGCATCTCCAGCAGATACGAACACTGATGGCGATGCACTGGCGACACTTGCCGCTGAC
GAGGAGACCCCGACCACGGTTGAGAAGAAACCAAAAAGGCGACGCGGCCAACGACCGTGCCGCTTCTTCGCCAGAGGCACCTGCCGAGACGGCGAAAACT
GCAAGTTCTCGCACGTGAAGAAGCAAGAAAAGCTGAAGAAAGGGGGTGGTGACGAAGCGTTGGATGCACCAGATGCGCATGACACCTCGGTTGTTAGGGA
AGCCGACCCAGCCCAACCGCCTGAATCGTCGGACACAGCAACACCAGCTGCGGAACGGAAGAAGAAAATGAAAACCCGTGTCCGAAAATGCAAGTTTTTC
GCACAGCACAAGTGCCGTGATGGAGACAAATGCAAGTTCTCACATGATGTCAAGGGTGCTAAAAAGGAATCCGATCCCCCGCGGCGTGCTGTTGTGGCGC
AGTTGGGTGTTCCAACTAAAACTGCGGTAGCAGCATTGGAGATTGTATCGGATACGACGGCAGAGGTCACCGCAACTGAGGAATCCAGTGTTGAACATGT
CGTTCCTAAAGGCGACGATAGCAGCGAGTGGTCCGAAGCACAACAGCGTGCACTTGATCTGGCCCTGAAGAAATACCCGGCGTCAATGGACAAGAAGGAG
CGCTGGACGAGTATAGCCAGCGAAGTGGAAGGCCGCTCTCTGAATGAGTGTATTGACCGGTTTAAGATGCTATGCGAGCTCGTCAAGCGTGGTGTGGATC
CCACTACTGCTGCCGCAGCAAAGATTGAACAAAAGCAAGAACAGGTGCAAGAAGAGAAGAACGCAACTGATGCAGACAAAAACGAAGGGTATGTCCAAAA
CTTGAAGATCACTCCCCCAGAGAAGCGCGTGGCGGTTGAGACTGAACCTGACGTCAAGGGTACTCAAATTTGCCTCGACGATCTGTTTCTGCATGAGGTT
GGAACGCTTGTCGCCCATCGACTTGTTTGCCAGATTGAGTGCGACAACTGCCCCCTCAAGTTTGACACTACCCTCAGCTTGGACTCCCCAGCGATCCAGA
AGTGGTGCCCTCGATGCAGCGTGCTCCACCACATTCTCATGAGGCCCGTATTCGCTCACTCGCAGAGCAATGTGCTTGCCTACGTGGATACCGAGAACTG
CTCCATTGTTGATGTGCTCCCATCCGACATGCTGGCCACTTGCCTAGATTGCGGATGCGAAGCATTGCTGGAGAGAGTTGCGCCGAGGCAGCGGTCTGAA
CAAGCCTGCTTTTCTTGCCACATCAAGCTCGCTGTTATGGCAAAGCGCTTCGTGGCAGGCCAGCTAGAAGGATTAAGCAGTAGGCGAAGCAACTCACCCG
ATCGTTCCGCAGTCAAGGCGGCGAGGGGCAGCAAGAAAGGAGCCAAGGAACCGACGGAAACGTTCGTGCTGGGCCAGCCGCTTCCGCGTAATGGAGCGTG
CGATCACTACAAGCATTCGTTGCGATGGTTTCGGTTCCAATGCTGCGGCAAAGCGTTCCCGTGCGACGTATGCCACGATTCGAGCGACTGCCCCGAAGCC
AACCTGGGGAAGTTTGCAAGCCGGATGATATGCGGGTTATGCTCGAAAGAACAGTCGAGCTCAGTGAAAGTGTGCTCCTGTGGCAATGATGTTGCAGCGA
AGAAGACAGCCTCTCGCCATTGGGAAGGCGGGACTGGTTGCCGTGACTCCTTGCAAATGTCACGCTGGGATAAACATAAGTATCGTGGCCAAACCAAAAC
GGAGAGCAAGAAGTTTAAGCGCGTTGGCGCCGAAGCCAAGAAGCGAAGAGAGAACGCCAACGGGAATGCCAACGCGCAACAGTAGAGCGATCATGTAAGA
ATACCACTAGGTCGTCTTCGACTTGGCTGGGAACACCAGTGGTATAAAACGCTGGTGATGGTACCGGTGTTAATTGCCATGATAAGGGAGAACTGTGGCC
CCTGCGAGGGCCACACCCATGAATATCGCGCGTGCCGCAGTTCACTTTCTGAAGCTGGTACATGGGTCTGTTGACGTGCATTTCCTGCCTCAGTCTGCCT
TGCTGAAAGTTGCCGTTGAACCTGCTCGGTCGACATCCTTCTGGCTGGTGTAGCACGAAGGTTGCGCCAGGTTACGCTTACGCGTCCAATTAATCCGTTG
GGAGCTGTCCACCCCCTCATTCGTCGGGTGTTCCCAGTATAAACTATTCTGAGCGCAGTTGCTTTCGTTGTGTGCTTCCGGGTTGCCAGTTGTCTTCTTT
TTGAGCATGGTTCACTACACACTGGCTGGGCGCGTGAGCAGCGAGGAGTACGCTATCTGCGACCGCCTACTTGGTACGATAGTCTCTCCTTGCACTACCC
GCTTCAATCTGTTAACCCGGTTCGCTTTTGCAGACATCCTGGCCGCGGTTTTGCCCGATTGCCAGGTAACCAAACGCCCATCAAGGACCGACCGCTGGCC
CAACGACGCTGCTGAGCTGATGAGGTTGCACGGGTAAGACCCGCACAAGCTATTGTCGTCGATGAGAGGATTGGATAACAAACATTGCATGTGGCTCGAA
ACAGCTTCAACTTGCCCACTTCGTCAAACCTCGTGATCAGCGACGTCGCCATCTGGACCGACACGGGTCGACTGCTGTGCTCAGACGTGGACACCTTCAG
CACCTTTGTAGGACGAAACTACGGCGTGCAGTTGGACCTGACCGAGGCGGAGGTGCTGCTTTACATCAAGGCTAACGTGGACGAGCTGCGCAGGCAGGAA
CAAGACATGGCTACATAAATTTCCCCCCGAAACGTGAAATTCACAATAGAAAATCATACTTCATTTGTGGCGATCCAGTTCCGATTCGATGATGAAGGCA
GCGGTGACGGCGCTGCTGCGCGTGCGCCACAGCAACCAGGCTGCCACCCAGCGCCTCGCCTTCTCCACCGAAGCTACCGACGCGGCTGCCGCTGCGTTGC
GCATGGTAATTTGCGCGCTGTCTCTGTGGAAAGCGCCGTGTTGTAGGCTCTGAGCTCGAATGTTTGCGCGTCAATGGATTGATAGGGCTTCAAGAAGGCT
CAAAAGGACGAAAACGACGCGCTCAAGGTGGAGGAGGAGGCAGAGCCTGTGTCGCCAACCGATGTGAGCGCGGTGGCGCCTCCAGTAGTGGAGAAGAAGC
TTGTGCCGCCGGCCGTAAGCTCCTCGCAGCCCTTATGGCTCACGCAGGACCACCCCGTGACGGACTTGTCAGCCTTCGCGCCCAAGATTGTGGTCGTTGG
TGTGGGCGGAGCTGGAGGAAATGCTGGTAAGAAGCTTCGTATAGACCGATAGAAATGGCTAATGCTGCAAGCTGGCCAAAGTCTCTAACCAGTTATGGAC
TTTCATGGACAGTGAACAACATGATCGCGCGCGGCCTGCAGGGCGTCGAGTTCCTGGTGTGCAATACGGATGCACAGCACTTGCGTACGACCTTGACGGA
GAACCGCGTTCAGATGGCCCCTGAGCTGACAGGAGGTCTGGGGTGTGGCGCCAACCCCGAAGTTGGGTGCGTGTTCGGGCTACGGCTATCACAGGGTGTT
GGATTATCAAAGGGTATCAGTTAGACTAAGCGTTTTGTTTTCCGTCGTGTTAATCCAGCCGTGAAGCAGCGGACGCGTCGATCGATGAGATTCTAGAACG
CGTTCAAGGTGCAAACATGGTTCGTTGCGTTGACTTTTCAAGTAAAGCTGGTGGTGGACCAAGTAGCTGCTTACGCCACTATCTCTATCTGTGTGCAGAT
GTTTGTGACTGCAGGCATGGGCGGCGGAACTGGCACAGGTGCAGCTCCTGTCATTGCTCAGGCAGCTCTTGACGCAGGTATTCTCACGGTGGCAGTCGTC
ACGAAGGTGTGTAGCGGGGATGCGTTGCGATTCAATTAGCATCATGCACTAACATCCCGATTTATTATCACACATTGCAGCCGTTCCGCTTTGAAGGCAA
CAACCGTGCGAAGCTGGCAGCACAGGGCCTCGCTGAGCTGAAGGATAGCGTGGACACAATGCTGGTGATTCCGAACCAAAACTTGTTCAATATGTCGAAC
GAGCGGACGTCGTTGATGGATGCTTTCCGGTGCGCGGTTTTGGTTGAGGAGGTATCGATGCTGAGTAATTCTAACGATGCTTGTTTCTTTAATGCAGGAT
GGCGGACAACGTGCTCCTAGACGGCGTCAAGAATATCTCTGATTTGATGGTGATGCCTGGTCTCATTAACCTCGACTTCGCGGATGTTCAGTCGGTACGT
AAATTTGTCTTTGTCCGTTGGGCGGTATCCCTGCTAACTTCGCATGGCGATCGTTGTAACCGCAGGTGATGCAAAATATGGGAAACGCCATGATGGGAAG
TGGAGAGGCCGATGGAGAGAACCGGTGCGTCTGGCTGTTATCGACGATTATAGGCAGGTGAGACGATAGGCTAACTGGTCTTGTGTTTGCGGTCGCTTGT
AGGGCGCAGCGTGCAGCTGAGGATGCGTTGGCGAACCCTCTTCTAGGAGATATTTCGATCAAGGTACACACTGATTTCCACCACTTAAGTTTGGTAACTC
TTATTATGTTTGTGTTAACGAGTATCTTATTCATGCTTTCTTTCTTTCGCAACGCGCAGGACGCCAAGGGCATGATCGTAAATATCACTGGAGGCTCCGA
TCTGACGCTGTTTGAAGTCGACGAAGCTGCGGAGAGGGTGACGAGGGAACTGGACGACCCTCACGCCAACATTATCTTCGGCTCGACGTTCGATGACTCG
CTGGATGGCAAGCTGCGCGTCTCCGTTGTCGCTACGGGCATCGCTGACCCGGAGAAGTTATAGATGGTGAACTTGTGTTGGAGCATGTTCGACAAGCGAG
CATGGAGAATCAACCGACAACGATACCTAGTGATTCTTCGTTCCTTTTGTTTTCGTCTTGATTGGCGATTAGTAACCACAAGAAGATGAAAAGAAGAAGG
TTGATGATGGCAACCCATGCTGATCGCATTGATATTATACTTGACTGCTTCATATTTAGTTTGCACAACGCCCTTCCTGTGGGGCGATGCGGCACTGTTG
GCCGGCTTAGCAGCTACCCCAAGAGGCGGAAAGCAAAATTGCACTATCAACGCCACACCTAGAACGCGTATTCCTTATCGTCGACAGAGAAAAAGGCTTG
TTGCGAAAGACGTTCGGGCGGCAAGGATGAAAGCGCCTCATCCAGGTCGTAAGACGCCCACATGGATGTGAGCCGGACAACAACTTCTTCGCACGTGAGA
CGAGTTCCCTTGGGCACCACCACCTGCTTCATCGCTTCTTCGAGCGGTACGCCCTCATCGTAGCAGCGCTGATCATCATATTTCTTGCCGTAGCCGTCGT
CGTCGCTGTCCGAGTAGTCCATAATGGGGTCTTCGGATTCGTTCGGCTGTGTGGACGCATCGTCCGACCGCGTACTCATCATCGCCTTACTGCGCGAGAA
GATGGACTTGCCGCCTGAAATCTGACTTTGAGTGAAAATGGGCCTGCTCGACGACTTGCTGGCGCTGAAGAGCTCCCGGCCCATCAACGAGGGCGAAATG
GGCGGCGCCGGTTCCGGGACGGGCATCACCGGCTGCTCCACCACGGCGTACGACTCCAACGACAGCGACTTGTTGATCTTGGGCAGGATGGACCCGTTCA
TCGGCTGTGCTCCTCGGATGAGGAACGGCCGCATCAAGTCCTTAATCTCATCGCCGCAGATGCCGCACTTGGGGAGATCGTTGTAGGTGCGCCCCACGAG
CAGCTTGAGGAAGTCTTGGAGCGCTGACACGCGGTGGCGCACCACCGAGTTGGTCCGCATCAGCGACTTTCCCGGGAAGCGGAACTTGCTGATGGCGCGG
TTGAAGCTGGCGCAGTTCGCGCACGAGACGCCGCGCGTGCCGAGTTTGTGTTGGATGTCCTTCCGAAGCTGCAGGAACTGCGAGTAGCGGCGGTTGACTG
TCCACTCCTGGTTCGTGGGCTGTACCAGCATGCAGATGCTGTAGAGCGTGTGCGTTGGCCTGTTGAGCGCCGCCGGGATGAACACCTGCACCCCGCTCTG
GAAGTTCATGTTCGACTACTGCACTCGTCCGGATCCCTGCGCTACGCTACGTTAAATGGCGCACTGCTCGCCGATGGGGGGGGGGGGCCTTCGTCGCCTT
GCTCTCCGCCGTTTGGACAGGCGTCGCAGCGCGGGGATATGGTACAACGTGCAGGGCAGGCTGGAGTTGGCTGCTGCAGCGCGCGGGGTTGTGTACGTCG
GCTCCGGGGAGTGACGTGGGGTGGTGGGCTGGAAATACCGACTGCAGCACGTGGGGACGCTGGATAGCGGGCTCTGGCTGGATGGTGTGCCCGCCCGATA
TGCGACCGTGTGCGATATCCGCCGTGGCCCGTTTGCGTCGCCACGACCGAGTTACGCCAGGCTGGGCCACCGAAGGCTGCAACCACCTGGACCCGTGTGT
GGTTTCGGAGCTCGGCCCTGGGGCTCACCAGCTGCGCCGCTGATACAAGTTGGCCAGGGCACTCACGGCGTTAGTTCAGCCTCGCAGATCAGACAGGCAA
CAACCGTTCTGCAACGCAGGACGCCCACGTTACTCTTTGAAACTGCAAGCATGCTTTGCTTCAGAAACCAGCGCTAATATCCTGCACTGTCAGGCTTGCA
GGCCTGCTGCGCGAGAAGGACGGAGCTCAGACTGTGCCGACCGGCTACAAGGCGAAGGCCGCAAGCTTGCAACCGCCTTGCACTTGCCGCCGGGGGTCAT
GTGCTCGTCGAGCGTCGAGCGTCGAGCGTTGAGCGCTGCTCGAAGTCTACGAGCCGAGCTCGAGATCGGAAGCTTGGTGGAGCCAGGAGCGCTGGCGCGT
CCCACGATACTGCAGCATAGGGAACGTCCGCCTCGCACGTGCACACGATGTGATCGGCCTCACAAAAAAGAACAAGTCGCGCCTCGAGCCCCGCTCCGTC
GCGGGTGCCCTTGCTGCCGCTGTTGAATTGATCCCGTCCCCACTGGGAAGGGTAGTTGGTTGCACACGGGCGCAGCACTACCTACACTTTGGGCTACAGG
TACGTGTGCATTATCGGCGACCTTCGGCGATCGACGGACGCAATGCTCGCCAGCATGGTCCGACCTGAGGGCGCGACTTTCGCGTGGGCACAGGTGTCGT
CTTGTCGGAAAAAAGGGCGCGACTGTCCACATTGGAGTATTCTACACAACTCCCGCTGAAATGGATTGAGATCCGTTCTGGCAGGTATGGTTGGAGTGGT
CCACACGAGCGAATGACGAGTCGCCCGCGACGTCATCATGGGTGGCTTCTGTGAAGCGCAGCAAGAAAGTATCATTTCTCAGCGCCGCGCTTACGGCATC
GCGCCCGCCGCCTTGCATCACCGCCGCTCTCTCTGCGCCCTCAGGACGAAGCACCACACCACAATAAGAACTACCAAGTAATAGCCAGCCATGCTGTCGA
CTCTGCTGTGGATCGCGCTGGCGCTCCTCGTGCTGCTCACGCAGAGCTACAAGATCGTGGCGCGCTTCCTGCGGCTGCTGCTCCACACGTACTTCCGCAA
GATCGTGGTGTACGGTCTCAACAACTTCCCGCGCGAGGGGCCCGTTATCCTGTGTCCGAACCACCCCAACATGCTCGTGGACGCCATCCTGGTCATGACC
GAGGCGGCCAGCCACGGCCGCAACCCGTACGTCTGGGCCAAGGGCTCGCTCTTCAGCAACCCCATCGCCGCCTTCATCCTCAAGAAACTTGGCGCTGTGC
CCGTGTACCGACCACGACGCAAAGAGGCTACTCTGGCTGACGTGGACTCGGACAAGACCCCTGAGCAGCTGGAAGCCGCCAACAAGGCCATGTTCGAGCA
CACCTGGCGAGTGCTCGCTGAAGGCAACGTCATGGTACTCTTTCCCGAAGGAACGTCTTACACGGCGCCCAAGATGCTCTCGCTGCGCACGGGAGTGGTG
CGCGTGGCGACGGGCTTTGCCAAGCACTACGATCAAGCCATTCCGATCATTCCCCTGGGGCTCAACTACTTCAACAAGGACCACTTCCGGAGCCAGATGA
CCTTGGAGTTTGGACCGCCCATGGTGATCACGCCAGACACAGTTCAAAGCGAGGCTTTCCAGCAGGATGAACACAGCGAGGTGAAGCGCCTGACGCATGA
GCTCGAGGAGAGGATGCATGATGTGACCTTGAACGCGTCCGACTTCAGCACCATCCACGCGGCGAGAATGATGCGGCGCTTGTACTTGAACACGCCTGGG
TCCATCGACGCTAACAAGGAGGTTCGCTTGACACAGTACATTATCAACATGCTGGAGAAACAGTCCAAAGACGAGGAGCAAAAAGAAAGCATCGCCGCAA
TCCGCGAGAAGGTCCTGCGATACAAAGAGCAGCTCGAAAAACTGCGCCTGAAGGACCAGGAAGTGAATCTTTCGGTGCCGAAGGAGCAATCGCTGTTGCA
ACTTTTCCTGGGGCGAATCCTGTACCTGCTGGTGCTGCTACCGCTAGCGACACCCGGTCTTTTGCTGAATCTCCCCTACTACTTTATTGGTAAGTGGTTT
GGTTCGGGTGGTCGTGTCTATATAATCTGACCTCCTGCGCCGTTGCATGATTTTGTGTTATGCAGGAACGAAGATGAACAGTCTTGCTGGTTTCGTGGAA
TCCAAGTCCATGTTTAAGATCTTCGCTGCAGCGTGAGTGAACTGATTGCAATAAATTCCTGGTGGCAATGCCTCCCTCTAACTCTTGTTTTCCTGCTGCA
GTGTATTGGTGCCCGTACACTGGCTGGTGCTAATTCTCGCCACTTGGTTCTTTCTGGGCTCTGCGTATGCGTATACGCTTGCCGTGGGGCTGCCGTTGTT
GCTGTATTCGCACATTCGTGTGCTGGAGGAGAGCCGTTCCATTGCGGAGAACGTGTATTTCCTGTTCAACATCACGGCCCACGCTGACAAGGTCGAGGTG
CTTCGCAAGGAGCGGGAGTTGCTAGCGCAAGAAGTGCATGACCTGGTGACCGCTTACGTGGACGCCAAGTTCCTTTCGACCGTGCACAAGTCTCTCGCGA
GCTCGCCAGCGAAATCACGGCTGCGCCATCGAGCCTCCTCCACCAGCGACACGCTGCTCACGAGATGATGACACCACGATGGTGCCGCAGCGTGCTTTTG
TTGAGCAGCCTAGAAATGTTAAACATTTCTAAACGCTTTGCAGAGTGTTTTTTTTAATCGATATTCGTATTCATGAAATGTGGATGTGATTGCTAACCCT
TGTTGTCCCGTTCGGATTGCAAGTCTACGCAGTTTCAAACGACTTTATTCCGTGGCGGACTGGCGCGCCCTTGCCTTCGGATTTTGGACTTGATACAATC
CAATGAATCCGTTTGAGTTTCTATGTTGAGGC