Description :
From Genome Similarity Track
Location :
Scaffold_1983:391- 3402
Sequence
3011 bases(100 bases per row)
CTTCGTACAAGAACATGAAGGGATCTGTCATCCAGTCACCTTCGTCAGCCGGACGCTAAAGCCAAATGAACTGAATTACGGAGCGGTGGAGAAGGAGATA
CTCGCGCTCCTGCGCGTGTTGGATCTCAATTACAACCTGCTGGTGGGAAGATCCATCCGGATCCTGACTCGGCACTCTACACTAGCCTGGCTGTTCAAGT
CGGCCGGGTTGCAAGGACGTTTGGGACAGTGGGCAGCTTTACTCTCGCCTTGGACACTGGAGATTGTGAAATGTTCGAAAGGGGAAGACGAGATCCTGGG
AGACTTGGCCGCGAGCATCACACCTCGAGCCAAGATGGACGAAGCGCTGACTAGGATCGCTCCTAATAAAGAGCCCAAACGTCGAATCCAGATCCCGATC
CCGACGGTACAAGTGGATGAGGATCTGTACGTCCTGAGCTTCGATGGATCTGCTCGCGTGCGACGCGGTGGAGGAGCATACAGCGCCATACTGTGGATTT
GCCCGGATGGGAAGTGGTAAGGGCCAGAGCCTCCTATGCGGAAGGTCTCACCGTCAATGAAGCGGAGTATAACAACGCCTGCTGGGTTTGGATTTACTAA
AGGAACCGGATCCGAAAAGGCTGGTGATATATGGAGATTCAAACTTGGTGATCCGACAGGTGTGAGGTTAGATTGACTGCAAGCCCCCGGCCCTAACGCT
GTTACGGCAGAAGGTGATGGTCCACCTGCGTGATTGGATGAATCACGAGTTAGTACATGTCAAGCGAGATTGGAATGCCAGTGTGGACAGCTTGGCCAGT
GCCGCTTTACGGAATCAATGTGGTGTCGAAGTGAAGAGAGAGGCCGAGCATCAGGATCTCGTTACGTTGAACCGACTAGACGAAGTGGTGGTAGTTGGAT
CCGTGAAGCGGACAGTCCAGGTATGGCTGTCACTAGGTCCAGAGGAAGGATTGGATCTAGCCCCCAGATCCTCGATGAAGCATTTGTGAAGGGGGTCCGC
ATTGAGCGGATCCTCAAAGCACAGAACGAAGAAGCGTGGATCCTAGGACTAAAGAAGTATCTGATGGCAGATATACGAGACTTGAGCCGGATGGATGCCA
AATCCTACAGCATTATCGCTACGGATTACGCAGTGGATCTGAATGACTTGCTCTTCTATTGCCCCCCTACGAAGAGAGTCCACGAAGATCGGGATGGATT
AATGAGATTGGTGATGCCAGAAACCTTACAACAGGATGTCCTACACCACTACCACGCTAGTTTAGAAGGTGGACATCAGGGGATTGGTCGGACCTACCAA
CGGATCCGGGAATGTTTCCACTGGAGGGGACTATTCAAGAGCGTGCAACGATATGTCGGTGAATGTGTGGATTGTGAGACAGGCAAGGGCAGGCCCACAA
TCGAAGGGGAGTCACCTGGGAATGTCCAAGCGACTTACCCTTTCCAAATTATAGCCATGGATCACATCCCCTCGTTACCCAAGTCGTTCAAAGGAAACAC
AGAGTTGTTGAGCTGGATAGATCTGTTTACCGGATATGTGATAGCCAAAGCTAGCGCGTCTAGAACTGCACAAACCATCGCCGAATCGTACGAGGAGTGC
GTTTTCCGAAGATTTGGAGCTAGTGAGATGATTCGGCATGATCGGGAGTCAGGATTTATGTCTGATTTCTTTCGAGCCTTCAACCGGATCCTGGGGCAGA
GACAGCGGGCGACTATGGCATATCGTCCCCAAGCAAATGAATCGGCCGAACGCATGGTACAGACGATCACGAGAGCGCTCAAGATGTATGTTCAGGATTT
GGATCAGAGGGATTGGAATGAGTACGCAGAACGACTCCCCTTCGCGATGAACATCGCCCAAGACAGGATCCAGTGTGACACCCTATTTTACTTGGTACAT
GGGTGGAATCCTAAATCCATCCTAGAAGCAGCTATTCCGGTAGGTAGTACCAAGAATAGGAACCGAGATCCAAGACGATGGCGATACCAAGTCCAGAAAT
ACTACCGGCAAGCCAGATCCCAAGTGAACGAACGGCTGCGGAGTGCGATACAAGATCAAGCGGATCGACACAACGAAGACGTCGTCCACATCAAATCCAA
GTGGGATCGCAAGTGTGGCTTTATTTAGATCGGGTGAAGGAAGGGTACGCCCGCAAATTGGCCCATCTATGGCACGGACCGTTCCGGGTGAGCGAAAAGA
TAGGGGAACGTGCGGTGAAGTTGGAAACGGCAGGTACCGAATATCGCTTGTTCCCTGTAGTACCCGTATCCAAGCTGAAGTTGGTCAAAGAATATCCGGA
CCGGCCGCAAACCCGTCTTTCGGTGGATGAATCCGACCGGGTGGATTTCGACGAAGTCCTCCTACCGGAAGATAGTTGGAATGTGGATCTCGAAGCCGAC
GAGTTCGAAGTAGAGAAGATCACCGACATGAGGTCAGGGAAGCGAACTAGATACGGACGGATTTACCGTAAATTTCTGGTGTATTGGCGTGGATATGACG
AACCCAGTTGGGTAGACGAGGCAGCTCTGAACTGTGGAGCATTACTCTATGATTACTTGCGGGATCGTACGAATCGGAACAGATTCCGCGTGATGCAGTC
TCATGAAGAAGAGTAGGAAGGGGATCCATGGATGTGAGTTGGTCATGTCGATAGGAGGATGAAGAAGGACCCACAGGAAGGGTGTGGGTCGGGAGGAGGA
GGATCGCTGATGTGAGTTGGCCACATCGGAAAGAAAGAGAGGACGAATCCACAAGAGAGGGGTGGATTAAGAGGAAGGAGCGAATGGTTATGCATAAAGA
GTGACGTTTTACGTGCGAAGAGTCCCGCTTGATTTCAAGCGCGAGCTTTCGAGAGCCCGAGCTATACTGACCCAATTGAGACTGGGTCGTAGGCGCTGGA
TCCGGATGAAATCCAAGCGTGGATCCAACCCGGACCCAGAATTCAGCCCAGATCCAGGTGTACACTGAAAGGGTGGATCTGGCCCAGATCCAGGTGTACG
CAGAAAGGGTT