Description :
From Genome Similarity Track
Location :
scaffold_26:390987- 392517
Transcript NameFunction/comments
Plaha_PHALS_04970ubiquitin-like protein nedd8
Plaha_PHALS_04971ubiquitin carboxyl-terminal

Sequence
1530 bases(100 bases per row)
ATGCAGATCCAGATAAAGGTGCGTCGCCAATATATTTGCGAAATAGTAAGTGTGCTCGTCATTCTAAACAACATACTGGTTGAATACATCGTTATAGACA
CTTACGGGCCGCAAGCAAACGTTTAACTTTGAACCAGACAACACGGTACACTCTTTCTAATTTCAAGTTGACATGTTGATAGAAATAACGTACACATTCT
TGCGTTTTGTAGATTTTGCACGTCAAGCAGGCTTTACAAGAAAAGGAAGGAATACAAGTAGATCAGATTCGTCTTATTTACAGCGGCAAACAACTGTACG
TGATGCTGGAGAATTGATTTAAAGAAGGCGAAAAAATTGACGTGGACTATTGTGGAGCAGTGCAGACGACAAGACCCTACAGGACTATACTGTGGCTGCA
GGTGGCACAATTCACATGGTACTGCAATTGCGTGGTGGGTGCTAGGGGAGGAACGACATTTAGAACGTGGGCCATAGCGAGAGTATTCAGAAACTAATTA
ACAAATGAACCTCTCAATGACAAATAGTCAATTTTTAGCAATAGCTTGTCTTGATAGTTTCACTGTGCATTCGTAAGCTGTTGTTTGATCAGTGGCTCTA
GTTGTTTTTTCATTGCTAACGACTTAAGCAGCTGAATGATTAAAGGCGTATAATTGTGCTTGCGGCGCGTATTCTCCTGTGCCCATTTTTCTCGTTTGTG
TTGCTCAGCAGCAAGATCTATTTGAATTTGTGCCACTTCTTGTTCGCTTCCACCAGCTTCAATCAGAGCCTGAAGCTGTTCTTCGTAAATCTGTATCCGA
TTTTTGACGAGCGCTAGTAAATTAAAGCGAATTTCCGTTGCCGAATACCTTTCGATTCTCCTTTGAATCACAGGACATGCCACCTTTAGCCAAGAGTCAC
GAAATTCAGGATTTGGTACCTCGCCAAGACAAACAGGTCCTTCTTTAAGTCCATCAAGCTCATACACTTTGCCATTTACAGGCACGAAGGCTACAAAATG
ATACACATCGTCGTCCTCCGTCGCATTTCGACTCTCTACAACAAACTGTTCAGCTCGAGCGAAGGAATTATGGGTTAGCCGTATCCTGTCActgtttgag
atggctaaaCCCTTAAGATCTGGTGGAAAGTCGCTTGTAAAGGCTTTAAATTCAGATAATGTTTCACCCAGCTCTACGTCTTCAGCATTTAGTAGGATAG
ACAAAATGGCTTGTGTGGCACAAGCATTGCTGATTACTTGCTTAGCAAAGAAGATTCCGTCTTCTTGACTCGCAATGGCAGAATTGTTGGCATCGTTTGC
GTGGTTCGAGTCGTATTTGAAAAGAAACACGAGTCCGTAGACTGGCGACAAATCGGCAAACTGTTGCTCGTCCAATGTGTAAAGCTCTTCGACCTGCACG
CCTTTGACACCAATTTCTTCGATCAAGGCATTAAATACGCCTTTAATGGATAAACATGATTAGTTGTGGAGACTGGAGGCATCGTACAGAGGGGCGTACC
TGGGTCAGACTCGATAGTACACCACGACAT