Description :
From Genome Similarity Track
Location :
contig_29:390924- 392512
Transcript NameFunction/comments
g5804.t1hypothetical protein PHYSODRAFT_556912

Sequence
1588 bases(100 bases per row)
CTGCTGGTAAACTACGCCAGCAATATCTACGCTGCGCTATGCATGTAGCATACCTAACGCTATCTGTTTATTTTGCAGGAGCAAGAGCGTGAAATGATGG
AGCATGTGGCCAAGTACCCTGACCACTACACAGGAGAGCATTAGCCGTTCGAGGGCGCTCACAACTTCTGCAAGATCAGAAAAAACGTTTCAATTCATAG
AGTGCGTTTACATGTTGTCCTTTGCCTTTTAGAGGTAATGTGGCTCTCTCTGCTAATCCGCTAGGCTGGTCCAAGTTTTACAGTCATGCACCCACTTGCT
TCACGATGTACGTTTGGTCGCATGGGCCATGACGAAAGCGGCACGTCCAGTACTATTTCTTCGGATGTCGCTACAATGGCTTGCTTGACATCGATGTACA
GCGAGCGCAGAGCCATCTCGGCCAGTTCGCCTTCGTCTTCACATGGACGTTGCCTGCTGGAGGACGTACTTTTTGAGGTGTCATGTCGAGGAGCCACCAC
AAAGCAGACGTTTGGTCTGCCTGACTGAAGAGCACTTATCGCATCACTCACAAGTTGCTCTCGATAGACTTCATCTTCGAAAACCTGACGACAGTGTTGA
ACAGGTATTGCGTGAGCTGCTATAGACTTCATACGAGCAGGCTTGGTTATCTCGTCGTTTTGTAGTTCCTTTTCCATGGCCACCATGTCGGGTGAAACCT
GGTGGTCGTTTTGCCGACTGGTCTCGTTCAGGTCAGCAGCCCTCGTCAGCTCTTGGTGTAGGGAAATGGAATTGTAGCCGTTCTTCGATTCAACTACGTC
GTTGGCATCGACTTTAGGACCAGTGAAGTGCCTTTCAAGCGGTTTGAGTGCCAGGTTCTGCCACATCGCTTCAATTCGAGTCTCGCCATCCCACTTGGGG
AATAAATTATCAGGTGAAGATGAGAGTGAGGTGAATGTTGCGGTGGTTGTCACAGTACTTGGGTTTTGTTTTCGCGTCTGGGACGTACTTGTAGCTTTCA
CCAGAACGGAAGGCGGTTCATGCTCCGCAAGCATTTCTTCCATTGCTGCTAACTCGTCCAGGTACGTCTTCGGCCTTTTTTCAATCGTCTCGTGTTCTGG
CATGCTTGACTTTTGGGGATTGATACTCAGAGGCAGCGCAGGAGCTGAATACGAGGCATAAAGTGAAGACAACGTTCCAGACTCGTGGTAAAGAGAGGGG
AGCTTGCGCGGATGGTCAACGTACTCGTTGAACGACTTGGAATGGGCTTTTTGTCTTGACACCGCGATGATGTTGGAAGTAGCTGGCAGTTTTGGTGTTC
CCACTGTCAGTGCCACTGCTGCCGAAGGGAGTGATACCGCCTTAGACACGCACTACAAAGGGGCTGCGGCTCGTACAGCTGACTGCGATCTCTCTTTGGA
AGACGATGCTGCAAATGAAATGCTAACGCCGAGTGGAACTCAGTAAAGCCTCCAGCCAGACTCATATCCTGCTGCCGAACAAAGTCATCGAAAAACTCGC
AACTACGCAGCACTTTCTTCGTGAGGTATCCAGGTGGTTCCTTAGCGCTGTCGTCATGTTCATCGCCATCGATACTCTCCTGGTTTGC