Description :
From Genome Similarity Track
Location :
Scaffold_2021:3909- 5263
Transcript NameFunction/comments
Phyta_totarag14008hypothetical protein

Sequence
1354 bases(100 bases per row)
TAACCGGGCAGGACCGGTCGAATCTCTTGGTAAGCTGAGAAAGGCTCCAATAGCCGTTGCCAGTGTCCACCCAGAGTCGTATGATCATGGAGGAAGTCCA
ACAAAGCTCCTGGCGAGAAAGCTCGCGCATTGGCGAACTGACTTTCCAGATCTGAAGCACGACGGTTGCTGGTCTGAAGATCCGCTTGGAGCGTGTCAAG
TTCCCCCCTGAGGCGACCCAGCACGCTTGCCAAGTCTCGATGCTGAGTGGTGAGATGAGCCCCAGTGGTGTTAGCCCGGTCGAGCTCAGCTGTCAGACGC
GAGATCTCAGCATTAGCTGAGCTCCCAGACCCGACACTCAACATTTCCTGAGCTTGAGCGACACgaagatcgaggagctgaGTCTCGTAGTCCTCCTATT
GCTTGCGCAGACGCTCGCCCAAGACTTGACATTCATGGCCTAGCCGAATGGCATCTGAGGCGCTTGAGTTACTTGCGAGCTGTTGCTCGACCATCACAAG
ATATTGCAACGTCGACTGCAGGTAACGAGTCGTGTTCAGAGTTCGGAGAGCGAACCGCTCAACCCCGAAACACTGCGCCAGTGAAACCACCTCACGCTCC
AGCCCGAGCCTGATGCGAATGTCTGAGATGTTCACAGGAGGAAGACCAGTTGGCAGCAGGAGGTCAGTTGCTGCATCACCTCCAGTGATGGAGCTCAGCC
GGCGCAGCTCAACATCTGAGAAGGAAGTCACGCGGAAGTTCCGAGCGAGCCCGTCCGGAGCACCCACTAGGTTCTCTCCCCGGAGGATGTCATCCAGAGA
AGCCGGGATACGGACGTCGGTAGGCTGAACGACGACTGCACTAGCAACTTGCTGCCCTGAGGCTGTGAGCTGAGCATGACGCGCCGGCGACCGTGCAGAC
GCGGAATAGACCCCAGTGGACACTGTCTGTAGCAtcagcattgctgctgatgctgaagcagacgctTGTGATGGTGACCTGAGTACGGATGCCGTTTGCG
GCGCCGAAGGAATCACCAAAGCCGGCACTGTAGCCGCAGGTTGAGCTGAGGACGTGACCGAAACCGTTGTCATagcagtcgaagctgtcggagTGGTAAC
TGACGTGGTGATCGTGGTCGAAGATGCTTCCGCACTGACCGTAGCGACATTTGAGACCACGGACGTGCTGCCAGAGCTGAGAGGAACATCGATCGAGGTC
GTAGGAGCCGCAGGAGTGCCCTGTGGCCCGGTGTCTTGACTGCTATCACCTCGCGGTGAGgcaggaagctgctggctggaagACTCGTTGACAGCCATGT
TGAAGAAGCGGTGCGTGCTGGGATGTCGAAGACACTGGTCGCGCGCTCCGTGAG