Description :
From Genome Similarity Track
Location :
Scaffold_22:390898- 399799
Transcript NameFunction/comments
Pytul_DAOMBR144PYU1_G008463Protein of unknown function
Pytul_DAOMBR144PYU1_G008462Protein of unknown function
Pytul_DAOMBR144PYU1_G008461Similar to DDX59: Probable ATP-dependent RNA helicase DDX59 (Homo sapiens)
Pytul_DAOMBR144PYU1_G008460Protein of unknown function

Sequence
8901 bases(100 bases per row)
ATCGTTGGATCCGTCGATGCATTTCACAGCACCAAGCGGTCGAATGTGGATCTCAAAGTCATTCAGTGGCACGTTCGTAAGGTTGCAGCAGCTCACACAG
ATCGCCACAACGTCTTCGTGGCCAGGAAGTGGTTGCTTGTACGTGACGTGGAGTGAGAGCGGATCGGCACTTCCAGTGACAATAACAGCCTCGTGCTCGA
CATCATTGAACGAGTCCGCATGTAGGAGTGAATTCGATGAATGCATTTCGTTCGACATGATCTCTTGATGTTTTTGTGGCATGAACAAATGCGACGGATG
AAACACCTCCTGCGAGTACAAACTCTCCCCGCGTGTTGCTGTCGACAGTGAATAAAGCTGCTCTTGCATCCTGATGAGTACGTAACACGACACAGAATCT
CATCAGTAAATTGATCTCCCCCTCCCTCCACAAAACAACAACATGTTCCTTACATGTGATGTTGAAGTGACGAAGCAGACGCCGTACTCGCCACATGCAT
CTTCAGCTGCTCATGCTCCTGTTGAAGAGCGGCAACGCAAGAAGGATGCATGCGCGCCATCAAGGCCATGCAGTCCTGCAACGCAACTAGAGACTCGATG
CTCGTCTTGTGCTTGATTTCCTTGAAGTTTCCACTCTCAAGTCCGCCCAATTTCCCATCATCGAATGTTGTATTCGTCTCGTTTGGCTCGACTGTTGCCA
TTTCGCTCACGTGCTCGCTTGCGGACAATTCCTGGATCTCCAGATGAATCTGCTCCAGTAATTTCTGAGGCGGTACGACCTGATAAGATGAGGACAAGTG
GATGCCTACCCATAGCAACTGGATCCGCACGTCACTCGCTGTGATCTGAGGCCACGCGCGCTGGACATCATTCTGGAAAAACTGCAGCGACTCGCGAAAT
AAAAGCGCTTGTGAGTGCACGAGATTCTGGAAATGAAGCGACAAGAGCGCGGTGTAACTGAGCTGATTATTTTGTGGCAATGCATTGCTCCTTCCAAGTG
GCTTGCTCTTCGCAAGCAAAAGTTTCTGAAATGCCTTGAGCACGATCAACTGCGCAACTTGTACACAACTTGCAGCGGACGGGTCAGTTCGAAGCACGAG
CGCTTGAACAAGGCAGCGAAAGACTTGGGACCCATTTGCTCGAGGTGCCAGTACAGAACTCCCTGAAGGCTGTCGGAAAAAATCCTTCGCGCATAACGAC
TCGAGCAGAAGAAATTCTTGTTTGCGCACAACACGGTCGGCGATAGCGTCCATGAGCATCTGGATGAGCCCCTGGCGATCACTACAGAGAAGTAAAAAAT
CACACGAGCAAGTTAGATCAATTTGTGCAAAAAGAGGAAGAGTGTTGGGTCGTACGTTTCGCGCTCCATGAGGCTGATGGCTTCAACTGTTCGGACAAAT
AGCTGGTCGCACTCTGACGGGGATACCCACGCAAACGTCTTCACGAGCATTTGACTCATCTCCAGCTTGAAATCCGAGCTCTTGTGGTAGTAGCATTGCG
CGATCAGCTGCTGCACCAACAGCGTAGCGCGTTTGAGCCGTGTGAACTCTTGAAGCGGGTGGGATAGCAGCAGGAACATGGCCCGACACAATGCTGTCGA
CTGTGCGAGGGATGTCTTCTTCGAAAACAACGGGCAAACCCACGACTCCAGCAGGTCGCTCGCGAGTTGGTCCATGCGCATCCGCCGTGTCGAGGAACTG
GTTTGGTCCTCGTCATCGTCGTCAGTCTGATTGGAGTCCGAGATCACGTCAATGTCGAGATATGACACACTCACGCCCGGGCACCGGGCGCCACTTTTCT
CCATCATCATATAGAGCAGCATCGCGACCCATGTGATCGCATCGGCCTGGTGCTTTAGCGAGAGCTTCTTTGCAGCACTCTGGATCGACAGAATCCGCGG
AAATGCCTCTTTGAACACGGACGTGATCACATCGTTCACCGCGGATTGAGTCAGCTGAGGCTCCTTGTTGAGACTGAACGCATTCAGCATCGAACCTCGT
GCAAACAGCATGCGCATCGCAGAGAATGCGGCGCCTGCGACGTCCCTCATTTCATTCTCAAAAAAAAGCGCTTGGAAGATCACTTTCCACGTATCCGTCA
CGATGATCCACAGATCTTGCTGGCAGCAAATCCGCGCTTCGTGGGATTCAAACGGGAATGCAAAGAGTCCATCAGCCGCGATGCTGGTCGCGACGTTGAG
CGACACCCTCGATAGCGTTGCAATCGCGCAACAGCGCACATCACTTTGCTCGTGGGTCAGCACTACGCGCAACTTGTTCATGGGCTCTTTCTCGGATGAG
ATCAAGAAAGCCAGGAACAGAGGGAGCGGGATTTGCTGCAGCAGCGGGAGCGCGTACAACAGAATCGGCGCATTTTGCGAACTCGCGAGCTCGGTCACAC
ACGCATCAAGCAAAAACTGCCATGTGCTGAACGTCGAGCAGCTCGGACAGCGACTGGCGAGCCGATACCCGAGAATCTTCATGGTCGTACTCGCCTCCGT
CTTTAAGCATTCCTATAAAGTAAACAAGCAAGCGTTCAACTCAGTGGAGTTCCCAACAACTCAACGCTTTCCATCTTTCGCGCACCTCCAAGGCTTCGCG
ATAGTCCTTGAGCGCGAGCGCGTTCCGCTTGGTCGAGGCCACTTGGAGCATCTTCTGCACTTTCGCGAGCGTGCGCTTGGCACTCGCAGATGATTCGCCC
CCGAGGCTCTCCTGCATCATCGTGGCCGCCGGTGTTCCTCTTGTCCTCCTGCGCAGCAGAAGGCGGAAGATCTACGTTTGTGGTTGGGTTCGCAGGATCT
TCACGCCATTCTTTCGTCGACGTCGTTTCGTGCTCGAGCGACCTTCGTGCGACCTCCCACTCTGATCTTCATGCCGAGGGTAGTAGCTCCGTTCGTGCTG
TGGCGGTGGCTTATCATGACATTCTCATTCAGCCAGCTTATGTTACTGACGATTCTGTGGTCGTGTGAACTTCTTCTCCATTGTATTCCATCGCTCGCCA
TCAATCTTTGTGATTCCGTCAAGCCACAGTTCCTGTCCGAGCCGAGATTTATTTGGAGCTGCAAACAAGTTACTTGTCGTTCCGTAAGCAGCGTCGTTCG
CTCTGATCGACTCGGCTTCACTGGTGGACGCCAACTTGGATGAGACGACACAATTGTACTCACAAGGCCATATCAGTGCCGCTTTCCCGCGAAATAACTG
AAGGTATAGTATGGAAGCACCCATAGGAGTACCAGAGTTCCTCTATTGAGTTTGGCGACTACGCCTCCCGTCAGAACCGATGGCGACACGAGACTGCATA
CTTAGTATTCCTGCTGGTTGGGTCCGTGACTAACACACATTGCCTTTCACTTCCTTATTCACACAAACTGTCTCCAAAGCCAGCATCATCGTGCGCACTT
TTCCGATCGTGCATGAAACGGGGAACAACTGATTCGGTATTGCAAACGCCAATCTCTTTTACACAACTCGAGTCAAGCAACTCTCGTTTTCTTTCGCGTG
TGTTTTCGATGACTCGTCATTCCATCATGAAGACGACTCTAATTTCGTGTCGTTTGTAAAACGCTGTGTACGGCAGTTGGTCGCGAGTTCCATGCTACAA
AGTTCACGTACGAAATTAGACCATCCTTACCGTCCCCGTCCTTTTCTTAGAAGACCAACTCTCAAAATGTGTAGGCAGCCGCCAGAAACACCAAAAATCA
CGTCATTGAACACTCAATCAACACGCACGACCGGCATGCCCCCAGATCCCGACCCTGCCGCGCTAGAGTGGTCGTACGAGCTTGTTCCGTCCTTCCCGCT
GCCTGTGCTGGACCTCTCGCGATCACTGAAGTCACGTTACTTGCCCCATGTCTTGCTCCAACGAATCGACGACTTCCTCGCGCTGTATAACAGACCTCTT
TTCGTCTGCTACGTTCTTAGCCTCGTGCTCAGCATATCCGTCCCGTTGTTGGATGCCGAGACGGGCTGCTATGTCGCACTCATTAGCGCTTTGCTCGGAT
TACCGTTGGGGCTGGGAAGCTTGGGCACCCTTCGATACGACGTTGTGCGTCTTCTAGTGCGCACGTACGATTTTTGGTCCTTCCTTTTCGTGAATGGAGC
TACGAATTTGATGGTCGCAATGATCTTTAGTGACCTCCGAATGTCGCGACTCATCATTGACTGGTCCGGCTTTCAAAATATCGTCTTGATTGACGCTCAG
CTGCGAGGAATCCGGCAGTTGTGGACGCTTGCAGTCGTTGGAACGTTCACCGTGCTCATGCTGCTGACTTGTGTGATGCTCGGTCGGGTTGATCGAGCCC
GGGGCTTCTCGATATTCCAGTATACCAATCAAAACAGCAGCTACGAAGTCTCAGCAAATGATGTCGTCGGGAACGGATTGGTGACCATTTTCATCCTGCT
CTTGAAGATTGTTTACAGAAAGCGAAAGGCATTTCGGAGGCGACCCAAGAAACAGTCTATAATCGAGTGCGCGATTTACCGATGTCGCGTCAAGTTATCT
CCATGCACCGTGCGTCACTTTTCCCCTGTCGAGCCCTCACCTCCAGATCCCGGGCTGAGTCCCAACAAACATCGAGACCGTAATATCCGACGACCCAGCT
TTGTGCAGCAAATGCAATACGTCAAGTGCGACACCGCGTTTGACTCCAGACAAATACTTCTCCCGATCCAGATCACATCCAAAGCACAATTTCCAGGCGT
CATGCTTGCTCTTCTTTACACAACCGGAGCCATAGGTCTCCTTCTCTCGTTCATAGCACTCACATGCGAGCCACAACAGTCAACCACCGAGTCGTACCTC
AACCAGTTGCTCAAAAACGGATGTGTCCCGTTCGTGCTGACGGCCAGCTTCACGATAACCATCGCAAGTTTCTACCAGTCAGAATTGCTCATCGCACTGG
CAACATCGTTCGATTTCGTCTTCTACGCGTTCCAACTCACATCCATACACACCTCTCTGTGCGTCTTGTATGAGTGGGACGTGAGTCGTTGCCTGGGAGT
TGCTGCATCCTGGCTCTGGATCCACTGGGTCTTGACACTCGACGCGCTCACACCGATGATGAAGGCAAAGTTGAACTTCCGCACTCGATTTGGGATTCCG
GTGGTAACCATGTTCATCCTCTGGCATGTCATCATACTGTTCCATATCCTGAGTGGCTCGGGACCAAAGGACCGCGTCATCTGGGAAGGCAACATCTGGG
CCCACCACCTACAAGTCAGAGTCGTGCCCTTCTACTTCAGTCGCTTGGTCACACTCACGCTATGGAGCGTCCGGATGGTAAATCGACTGGTGATGTCAAC
GAACGAAGATGCGACGATCTTGCGAGGTGCTGTCACGTACGACAACTATTTAGTTTCGGGAACGCGAAAGAAGTCACGCGCTGGGCCACGCACATCACGC
TTCATAAAGTACCACAGTCGCGTAACTCCAAAGGGCGCTGTAGATCAACCGAGTGATGTTAACAGAAACCGCGCTTATTAGGCTTGCCAACTGTGTTGAC
ATGCCTATTTTTGAAAGTTGAGTCTCCTGAGAGTCAAACAAGGGCCACTCACAGCTTCCGTGGATAAATAACTCTCAATGCGCCGGCCGCATCTTCTTCT
TTGTTTGTTCTGACCACTCGCGCCATTCTGCCACTGGCTTTCCCAGCTCATCGCTCACTTGACTCCGGACTTGAAATGCTCGCTTGGACGCATCAATAAC
AGCCGTGCTGGAACGGAATGCTGTTTTTTGTGCATCTTTGTGGAGACTCTGATAAATCTCGCGAGGCACAACCACCTTGACAGATCGCAAAACACCAACA
AACTCTGCAAACACAGACTTGTCCTCCGCATTCACCATCACCAGCGCAGTACCACTGCCTTCACTCCCTCGTCCAGTTCGACCAATCAAGTGAATGTAGT
CGGCAACTTTGCTCGGAAAATCAAACACCACGACATTTTGCACTTGAAGGAGGTCCATGCCGCGGCTCAATACGTTTGTCGACACCAGTACGCGAATGTC
CTCGTTCACAAATGACTCGAGCGCTTTCAGTCGTTCTTGCTGTGACTTGTCCGAATGAATGGAAGCGGATGGAATCCGAGTCTGCTTTTCAACTGCGTTG
GCTAAGAGGTTGGCACCAATCTTGGATCGCACAAACACCAGCTATATCGCAAGCACACAACAACGATACACAGTGAAGATCACCATCATGACCACAGACA
AACAGTTGATTGGATCATGATGAACATACCGTTGTCTCTTGCTGCTTGGTTTGAAGAAATTTAAACAGCTCTTTCTTCTTGGACTTGTCTTCGACCCAAA
CAACCGTCTGCAGAATGTTCGGGTTTACTGTCAACGTGTCAGAGCCGTTCTCTATGCTGTACCGATTGTTCGTGCCGATCTCGATATGAACAAAACCAGA
CACCTGACTGGACTCATTGGCAGAACCGCGCGTCAGAACTTGCTTCACAAGTGACTTGATACGTGCGGACATCGTCGCACTAAGGAAAAGCATCTGCAGC
TTCGAGATCGGTGGCAACCACGCCATTATTTGGATCATCTGCGCGTGGAACCCAATGTCGAGCATCATGTCCACTTCATCCACGACACAGCAAATCACGG
ATTCCAAGAAGGATTCTTGCTGGTGCTGAGGGCCACTGCTACGGTTGATTCTCGTATCCACATGGTGATTTGTGACGATATCAATGAGCCTGCCCGGGGT
CGCAATGATCACTTGAACACCTATACTCAGTCGATGCAACTGAGGAGGTATGGGGAAGCCACCGACCAGTAGCGCGGTCTTCATCATCGGAATCCCGTGG
ACAAGAGTCTTTGTCACATCTTCGATTTGAATCGCAAGTTCACGAATCGGCGCAAGGATGAGCACGAACGGTGTGTGTGCGTGGCCTTCCACAGACTGGG
CGTTAATGATTTGTGCAAGAGTAGGGATCAAGTAGGCTGCCGTCTTTCCAGTTCCTGTCGGCGCGATCACAAGCAGCTACGACAAAGATATAACGAACAG
TGTTAAGAGCATCTCGACAAAGCTTTTGCAAGCACTTGCTCGTACATGTTTCCGTTGCAATGCGCAGGGAATGACTTGCATCTGCACGGGTGTGGGCGTT
GCGTACATCTTGGCCCGCATGCTCGCGTACAATGCTGGCGGCAGTGCGCACTCCGCAAAATCCGTGATCGGAAATGGTATCTCGCGCTCATGGTGCGCAT
TGTTGTAACCCTTCGCCCTGTCTGCACGCTCTTTGTTGCCGTTGTCGTTGCCGTCATCGTAATAGACTCGAATCGCGAGCCGTTTGCGTAGCATTTTCGC
TGCTTGTGCACGTTGTATGGCTTGCGCGTGGGCTGCTGCACGCACGTGCTCATGTCTCTCGATGCACTGGTCGCGACACTCCATACTACACACATCTTCG
TCCGTGGCGTCGCAGATGTACGCGCCATAGCGACCGCATATCTAAAAAAATGAATGGTTCAAGCGGAAAGGTGAGGGTCGTAGCAAAGTACACCTCCATA
TACATACGCATGCAGACACGCAGACGCACCACACAGAGGGGATCATACTCCTCATCCCGTGGCATCCGCTGGTCGACCGCGAGCTGGACGACGACGGCGC
TTTCTCCTTCCTCTCGTTGGACAACTTGATCATCGGCTTGGAGGGCGCTCATCATCATTGCCGCAAAAGGGAAAGTATTGAAAATGCGGAAAACGTGGAG
GGCGGACGACGGTGGATCGACAAGGGTAGGGGTACACTCTTACCAAATTTGTACCCCCTCCCCCTTCGACACCAAGTCAAAATGGACAATGGGGAGGGCG
CGTAAGTGGAGGAACTAGGCACGATGCGGCTGGATGTAATGAACGGTATATTATGAACCGATGGCGAAAGAAACCACGTGCAGCCGCATGCTTCAGATCG
CCCATGAGAAGTCATGTGAGCCGCCTGCAGAGCCGTATGCCAACAAAAGCAAAGTCTCTTTGCGCCGCCATGCCGTCGCTTCCCTCCTGCTGTCGCATGC
GGAATCTCCTACAGATAAAGCCACCGATAGCGCCACTCATGCAACTTCATACTTCTCTCCAAGTGTGCATGGCGTTCGTGTTTACTAATATTATATATAG
AAAGAGAAGACTCGTTGTGTGTCGACCCTCTCCATTGCCAACGCTTGGTCCAATCGCTGTCCTTCTTCTTCTCATACGCTCTGTGCGGTCGCGAGCGGCG
GCGACGATGGCGTGTAGCGCTCCATGGGGGACATGTGCTGAGCTAAGGGCAGTTCCTCGTCCGAGTCTTCGATCTCGTAGTACGAGTTTCTTCGCACAAA
CGTCTCCGTGATGAATCCGAGTTCGCCTGCGTGCATCTTCTCGCGTTTCCACAGCACATAACATACGACCACGCAGACGCCATACAACGCTCCTGCCACA
CAAGACATCTCACGCATTAGCTTTCTTGTAAACTTGTAATCCATACGTCATAACCGCAATTCACATGACCAACAGCGCCCACTGACCAGCTTTAAAACAC
GCGTTCGCGATCGTCTCTGGATTCTTCGCGCCATGGACAAACATCGGCTGCAGCTTCAGCAGCGCTCCAATGATCGTCTGCACAAGAGTATACAACACGG
ATTCCACAAGTCAGTCGGTCTCTCGCATTCCACTCTCATGCGTCGCCCTGAGAAAGACATGACGACCGTACCAGGAAGATGAACCCGGCAAAGCCAAAGA
TGATCCCAAAGAGATACCCTACAGAGCAGCAACACATGTAGGCAGTGCGTTAGACTCCTTGTATATACGGCGGCATGCACCAGCGAACCTGCATTTCCGT
ACGCGCGCTCTTGCTCATGGTCGTTGTTTCCTTCCTTCCTTCTCTCGCGCTTCTTCTGTTTTGACAAATGGGACCTTTTGTTGTTCTCTCTCTGCAGATG
G