Description :
From Genome Similarity Track
Location :
contig_3:39089- 42019
Transcript NameFunction/comments
g727.t1hypothetical protein

Sequence
2930 bases(100 bases per row)
CACCGGCAGATCGCACTATCGCTATACTAATTGCGGTGCCTACGATTCTGGTGGACACCCAGCTGCGGACAGTTCTCTTGTGTCAAAATACTGTGGCATC
TACACTCTTCGGATCCTCGCTCCTCGCAGCGGTCGAGATTGCCGTGCGTCTGGCAAGAACTCTTCACGTAGCACGCAAGCATCGCTCGTTGTCCCAGTGC
GTATTGCACGTACCCAGGACTGCTCATGTTGTCCCGCAGCCGCATTTGGCCAAGTTTCTCTCTTCAACTTCTCTGCCAGACCAACGAAGGCTAAGCAGAG
CCAAGAAAATGATGGCGCTACATGCTGCTGAGGTGTATACCGACATGAACGCCGAATACATCGCGATGGGCTGTTCCTACGCGATTCTGTTCTTCTTTGG
TTCTCATACGAGATTCAACCTGGGTGATCAGACTGGTGCCAGCTACTCCATCTTCCCTGTCACGATAGCTCTGCAAGTAGGCATCGAGCTGGTGGTTGAC
TTTGGGTCAAGTGTGTTTGAAATTCGGCTAGGAATCGACTTCGAGAGTTTCAACGAAGACGGTGCATACCTCGCGTTTTTCATGATGGTTATCGCAATCA
CCAACATCCACATCTCGTCGGGCATCTATCTGATCACTCACTAGATGCAAAATATCCTTCTGCATGTAGTCGTGCAAGCGGTGAAGACTTCACAAATGTC
AATAATTTATCTCACAGTTTTGGTCGTGCAGGTTTCGAATTGGACTTGTTGCGGCTCTGGTGTCTCATTGTCAGGGACAACCTCATTGAATCAACGACGA
AAATGACGCTAGCTATTCGCAGCCGTGCTCAGGTGGTCGCAACTCGCTATTTCGAGGTAGTTCAGCAACTCTCAGCCCCGCTTCATGCGCGATAATTATC
TGACTACGCTTAATGCCGGTCAATAAGGGCAAGACGTGGGCCCAATTGGTGGTCAAGGTCCGGCATGACCGCGTGCAGCCTCTCACCCAAAGTTCAGGAA
CGACCTCCACTCACCAACGCATCAGCAGCTTCGGATCCCGAGCTCACCCTCTTACTATCGCATGGTGCACCATTCGGACGCTGGGCACGGTGTTAAGCAA
TTCACTGCTCAGTGCAGCTATCGCGTGGCTATTGGCGTTTTGCATCGACCAGGGCAACATTTTCTCCTCAGTGACATCGAAGGAGCAGCCACATGCGGTG
TTCCTCACGGCAAAGATGATTTGGTTCTGGATCTTCGCTTGGGTATTCACGATCGCCGAATGCGTGGCTAAATTGCTCCCAGAGACGTTCACTTCTCCAT
CTTCTTCTACGCCGTTCAAACTCTCAGCCACGAAGCTCATTATTAAGTTGGTGCGAGCCATGTTTGTACATATTGTGGGGGTTTCCGCCATGAGTATCGG
TGTCGGCTTTGCCATCGCGTCTGATCACCTCGCGCACAACATGTTCAAAGCTGATGTGTACTGGCCAATGATGTGCTACAACTTCATCTTGACTGTCACC
GACGCGCACACGCGCCACATTTTTCGGGTTGAGACTGTGAACGGCAAGGCAAGAGCCCGTCGCCCGAGTCGACATCAAGCAACCCAACAACCGCCAAGAA
CTCCTCGCCGAACGCCTTCTGGTGGCCATTCGTTCGTGTGTTTGTTCAGAACCTGGCTCTAGTCATCTCCGGACTATCTGCTGGTGCCTTTGTACACGTC
GCTAGCTCCATCGAAATGAAAGAGAAGTGGCAGCTCGTATTGTTCGCAATGTGCAGCCAAACAATCAAGCTGTTGATCCAAGCACCGCCAAATTGTATCT
GGGAAAGCGGAAGAAAACGCCGTCCATGCGCACAATGGCAATTATCGTGTCGGCTCCAACGATTTTAGTTGACACACAGCTCCGAACGGTGTTGCTGTGT
CTGGACAGCACGTCCATGACGCTAACAGGTTCGGTTCTGCTTGCCATAGCGAAGACAGGACTGCGACTCCTAACAGCGCTTCACATGAGGCATCAGACAC
GCAAAATTTTGATCAAGTACCCTCCTCCATCCGTTGCGATGCTTCCTCAAGACAGTACCATAAGAACTCATCGAGTCCAATCGCTATTGTCAGCCCGTGG
ATCCTCGTCGGCGCCGGAGCTAGAGGGAATTGCTCGTGTGCAAAAGTTGACGGGCTTTGCACGCTGCGGAGGTCTACGCTGACATGCATGGCGAATATAT
CGCAATGTGCTGCGCATACGTCATTAATTTGTTTCGGCTCGAATCCGAGATTTGTGCTCGGTGGGAACGCTTCCACAAAGTCTACCCACGAGATCGAGTT
GTCCACTATCCTGGTGCAAATGGGCATCGAGGTTGTGGTGGATATCATCGCGATCCCGTTAGAGATCCGCTTTGGTGTCAACTTCGAGAAGTTCCAAACG
GATGACGCCTTCCTCGCCATTTTCATGGTCCTTGTCGCTGTTGTCAGCATCCATATAGCCTCCGGGGTCTACATGAAAATTTGACGTGTCAGCACTCTGA
CAAAAAATAATGTGAATACAAAGCGTGGATCTAGCATCGTTGATGCAGTCAAACCTGCTTATATGAGGCATGGTTGGTGACCATACAGAACTCTGACTCA
TCACACTTAGTTGCCACACCGTGTGGCTCATATGACATGTGTGCATACAAGTAGCAGACATACTAAATTCAAGTCAAATGTTTGGTTCTACAAGAATTTG
CATCTTATAGACGGTGGGGCTCAAATAGCGAGGATCATATAAACAGGTTTGACTGTGTTTATTGCTCCAATGTAGAGGTACACTCCACCCGACCCCCAAT
TGGAAAGAAAGCGCTGTCCGGCCGACACCACGGGCATGGGCGAGACGGACACGGTGCTGGTACTCATTACCGGAGAGACCAGGGACTACATGTACGCGGT
CGTGGCCAACCTGGGCGTGGCAGCGTCGCA