Description :
From Genome Similarity Track
Location :
Scaffold_178:39089- 40741
Transcript NameFunction/comments
Phyke_g5977hypothetical protein PHYSODRAFT_351449

Sequence
1652 bases(100 bases per row)
tgaagaggcGGCTGCCGAACTTCCATTTGTGTTTGAATGCCCGGAATCCCCGGAGGAGCTCGGAGCGTtgttcaagcagcacgcgcGCAACTCGCCCGAG
AAGCGTAGCCTCATCGTTGAACGTATTGTGACGTACTACAACCCACGTTTGAGTGTAGAAAACcagaacaagatgaagcgcttcttcgcaGTGATGGTGC
GGCAATTCCTGATCTTTGCAGGGCGTTATGCGGCGCACAAACAAGATGTACGTAGTACTTGAGTCTGCCCGTAGCACTTGGGTATCCATTCTGTTGATTC
TAAATGTTCTGCTTTGTTTGTGTTTACTGCAGCTGGACGCCCTGGCAAAGAGTTTGTACACACTGTCCCAGCAGATGGGTGACACCGCCGGCATTATCTC
GCGTGAGCTGCTTTCGCAGCTATTCAAGCGGCTGCACAAGAGAGCCGCTAGTTCCGCATGGCCGACACTACcggagctgcttctgttcAAGGCGCTGACC
TCCGTGTTCCCGACCTCAGACTTGCGACACAATGTGGTGTCGCCCATGGAGACATTGCTGGGAGAGTGTTTGGCTCGTGGTGCCATGAATACTCCTCAGG
AGGCGACTCAAGCTCTTTTTGCGGTCTCGTTGTCGCTCGACATTACACGTTCCAAGCAGCGTTTCATGCCTGAGGTCATCAATTGTCTCACGCATATCCT
CCGCGCGTTCGTgacttcttcgccatctACTGAAGGAGCTCAGGAGGAAAACGGCACCAACAGCGCCCATTGGCTGCGTACTGGTTTGCTTGAATGGGTG
GCCGCTCAGCCGAAGGATCAAAAGATGACCGCACTGCCACGTCTCTCATTGGCAGGCAGCTCGTcttgcagtggtgctgaAGTGTTGAGCTcgctgttgg
cactgctTGACGTGTCATCAGAGCAGTACGCGTCGCTGCCGTCATTCGACGAGCTGTTTTACCCGCtgtatctgctgctgcacgcaCTGGCGCGTCAATT
GGAGGACTCGAAGATAGCTGAGGTGAATGCAATCATTTCGAAGTTGCACACGCGACTGGAGTCATGCTGGACTGCACGTCGTCCGTTGCGACTGCAAACC
TTTGCGCCGACGTCATTGCCGACCTTCGCGCCGCAGTTCGACGAGAACTACACTGTGCGAAAGGACAAGACCGCCCCCAAGGATACTGCACAGCTCAAGC
AATTGCAGCGCCAAGTCAAGCGTGCTCGCAAGGGTGCAGCCCGTGAATTGCGTCGCGATGCCGAGTTCATCCACCgcgagaagcagaaggaggaggacgc
aAGACTGCAGGCCAAGGAGGAAAAGCAGGCGGAGATCCGAGGCTGGTTGGAAGAGCAGAACGCCACGTTTAACCAGCAAGTGCGCAAGGGTGGAAACATG
CTCAAGGGTGGAGGCTCAGCTCGAGGACCTGCACCACGCGCGCGTCAGCCCCGGAATTAGACGAACTGTTGCAGTCGTACACACAGGTTTATGCTCTGCG
ACAGCCTCCATTTCATCAATAGAACTGCTTTTTATAGTCAGCCGTCGGATCTGTCCATCCATGTTGCAAGATAGGTTAATGCTCTAAAATAGGGGAACAC
CTGTTGACGTCGTTAATGGGCTTTCCACGACCGCAGCAAGTGGCTGTGCTGC