Description :
From Genome Similarity Track
Location :
scaffold_57:39089- 40587
Transcript NameFunction/comments
g5206.t1 hypothetical protein NCLIV_045400

Sequence
1498 bases(100 bases per row)
TGTTCGCTGTCTGGGTACCGCTAATGTCTCCATCGGGGTCATGCACAGATCATATAGCCTTTTCGGCTCAGCAGATTCTATGGTCTCCTCTTGTTCCATC
CCTTTGACCACTGCCCCAAGGTAGGAGATTGGTTTGCTCTCGCTTTAGTGCTCTCCAGCTTCGTCAATTGTAGTCTCCGGATCCACGAAAGTGAATAATC
ACAGTCTATCATCCAGCTCACCTTGCGTACTGTGCGCAATTGTGATGCACGTGTGCATCATCTGCTGTTGTCGCGTGAGCACGTGCTGCCTTGCGTTTGT
TCCAATAACCCGGAGTCGGCGGTACTTCAGCTCCATCGTCTCTGGTATCGGGTCACTCCATTTCGTTTTCTCTGCTTCGGATGGCAGCCCAGAATCCTTC
TCTTTCAGCTTCCCCAATGCTCTTGGAATCGATGCTGTCTCGCCATGTCCGTCAGTCGTAGTACGGTGCCGTACATATTGCCTCGGCTGTGTTGCTGAGC
AGGTAAATCCGCAATTATTTGAAAATCACCTGTCCGTCTCCCATATCTGCACTATTTGGCTTTGTTCCTGGGGTTCTCAGATTCCTTCCTTGATTCCTTC
TATCAGCCAGTGCCGTCGTGGCGATAGCTTCCGTCCGCTCTACTTGTTCATCCTTGCGCGCTGCCGTGTTGTCCCGCTCTCCTTCCCATCTGCCGTTGGA
CGGCCTTTAGTTCTGCCTACGATTCTCCCCTCGCTTGCCGCATTGGTTTTGCTCTCCATCATCAGTAGTCACCCTTGAAACCTCGCGTTCTGCTCGACCT
CTTGTCCAGCCGGCCCCTGGTCCTGCTCGCTGTGCTCAACGTACTCCCAGCCGTGATTTCCTTCGGCGATCTTTTCGTTATCTGTCTTTTTTGCCCCCCC
CCCCCCCCCCCCAGTAACCGGGTCGGTTGTTGCTGTATTCGCTGGACTTTGGCCCACGAAGTATCAGTATCAGTATCGTGAGCGGGAGCCGGCGGATTTG
GATGATGGCCTACCTTACGCACACGTGCCCTGAACAGACAGCTCCCGCGAAGAGAAACCATCGTTTCGGCACACACACAATAGAGGTTCCGCAGCCCAAC
CTCATTAACCTACGGCCAGGTACACCGCGACCGTCGTATCCGATATGAGGGCGACCCCAGACACAATTCAACACGGGGTGATCCCATTTCAGCATTCGTC
ATCATGAGCGTCCGTACACCGTAGACGAAGGGGCTAACCAACGATCTGTTCTCGGCAATACTCCGGACGATCAGGTTATAAGTGCTCAATGACAGTCAAG
GCAGTCCATCAACACAGCCCACCAGTGTGCAGGCACTTGGTGAGAGTGAGCAACAATCTGTCAGCCTAGCGCTCTGGTGTGCACGTACTTGGTGACGACA
GTTCCAGTTCGGTGACTAGATCTCAGTCTCTCATTACAATTATAGCGGTGCACAAGGTGACAACAACCGCCAGCTCATCAGCACGACATCAGCATTAT