Description :
From Genome Similarity Track
Location :
contig_3:390877- 392432
Transcript NameFunction/comments
g835.t1Amino Acid/Auxin Permease (AAAP) Family

Sequence
1555 bases(100 bases per row)
AGACTCATGCCGTTTGGTTGTAGTAAATCGTGTTCTGGAACTCGGGCTCGCAGTACGGGAACGTGGCATCCGAGTCCGACGGGGCGAACAGGTTCTTGCC
GGCTGTGTACGTTGAGTAGCAGCCGAGGACAAAGCACACCACAAGTACGAAGACGGCCGGGACCCTCTCGTACACCGGGACTTGGTTCCACGTCTTGATG
AGGTAGAAGATCGTCGGCAGGAGGATGCAGTTCGCTGTGATAGCCGACGCTCCCACGAAGTCGGCAAAGTCCGAGAAGTGGTCTTGGAAAATGATTGACA
GCACCACCAGCACCACGACAATAGTGACCCGCAGCACGATGTACTTGATCGTGTTGGGCCCGCGGTACTCCGCGACCTCCTCTTCATGAGCGTGATTCGG
CTGGTACTCAGTGGCTGTCACCGGCACAACTGGCGTTTTCGATCGACGGTCCGACGAGATACTGATGCGAGCCACATCGCTCTGCAGCAGAGTCTGCTTG
GAGATATCTTCCACGGGCGTGCCAGCTTCCTGGTAGGCCAGACCGTTTTCGATGTCGTCTGGGGTCTTCTGGTGCATGCCAAGGACTAAACGCTCAGCGA
TGTAGAAGGCCGGGTTCAGCAGAACACTAAACGCGATGGTAATGTGCATCTGCATAGCGAGGTATGCGAGTACGACCGAGCCCCACTTCGGTGCGAAACC
TACCGAAGTGAGGCCAGTGCTGGAGTCCGCGTAGATGGTGTACAAGATGTTTCCTCCGCCCTGGCACCCCATGGAAAAGTACGGCACAAGGCCCAAAACC
ATGAGCATGCACATGATGAACAGCATGGTGGCGCCACAACACGGGGCATGCGGGCAGGGTCGCTGTGCTGGCGTTGTACATCCGGAAGCACGATGCCAGC
GCCGTAACCGAGCGACAGACTGCCGAACGCACCGATCACTTGGCCCAAGTCGAGATCGGGTGTCGGAATGCTCGGGTGGCCCTCCATGCCGTGCACGATG
ATTCCGATGGCAAGACCGTCTGCAACAAGTGTGCCCATGCAGCCCGCGAAGGCCGCGCCCGCTCCCTCCTTCAGCGTCGGGACTAGACACAGAGGCAGCA
CCGTCACCGCCATCAGGACGATCCAAACCGTGGGGCTGAAAGCACCCGGGAAGAGTCCATCTAGCAGTCCTCCGCCGAGAACGAGGAATACGCACGGGAT
GAGCAGACAGGAGCCCATTTGCGAGATCACTGCCAGCCAGCGGCCAGTCTTGCCCATGCTCCATTCACCGAGGTCGCTGAACGTCTTGACGGATGTCGGG
GCCAGCAAGAGCACCTTCGACATGGATACCGAAGCGTAGATGTTGGCGAACGCCATGAAGGCGGTGGCAAAGAACCCCAGCACGGGACCCGTGCGCGCAA
AGTTGCCCGGCATACCGAGCGTGCCGATGCCGCACATACAGCAGAACAGGCTGAAGGCCATCTTGAAATCTTCAAGTGTGAAGAAAGGTTGCTTGGCCAT
GGTTCCTCAGTTGATGCAGCGAAGTGACTTGGACGATAGGGTTTAAGTGGAAGAC