Description :
From Genome Similarity Track
Location :
Scaffold_90:390814- 398519
Sequence
7705 bases(100 bases per row)
TATCTACCTATAAATGTACTCAGTTTACATTCTACCTTAAATAGGTCACTTCGCTCCCTTTTCGATAAAAGGGATCTGTGAACTGACGTTCACTGAGAGT
TTGTATACTCTCGGAAGCTAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTCGTAGTCAATCCACGCCACCGCGGGTAGAC
TACCTGAACCTCTCCGAAGTTCGTTGCCATGGACAGGAACGACTTCTCCCATATGAACGACTCTCAGCTCGAGTCGGTTCGGAAGATGGCAGGCATCTTC
GGGATGGAGGCACTGCAGAGCCTGGTGGTGTCAGCACCGGCCGGGAAGCTCGAGCGCGTCAATGCGCTCGAGCGCGTATGAGCAGGGCCTCATCGCGCAT
GTGCGGGAAAACCTGCAGGCTCCGGCGGCGGAAGCAAATCCGCCTCACCCGAAGCCAATACGGCTGAAGGTTAAGCCGTATGAAGGGAAGGAATGCGAGA
ACCTTCACTTCTGAGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTTCGTGTTGCTTTTGCACTCTCCAACCTTAGCGG
CCGTGCTAAGAGTTGGGTGTACACACGTGAAGCAACATCCCCTGGATGTTTCACATCCTGGACTCAGCTGTGTGAACAGCTCCGAGCCGCGTTCCTCCCG
GCGAACTACGAGTACCGCCAGCGTTCGCGCTTCCTCTCGTGTAAACAAGGGAGGCGTGAGCTGCACGAGTACGTGCAAGAGATTCGGGAGCTCACGGCGT
CCCTAGTGGGAAACCCACTCAACGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGAGTGCAGTC
AAACACCCTTGAAGAAGCGACTCAAGTAGCTCCCCCAGAAGAGTACAGTCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGATTGGCCTTGTC
GACTCCCGGTCGAACGAGCCCCAACGGAACCAGTTCCCATGGAACTCGGGTCCCGCCGGATCAGCGTGACATTCGCTGCTTCGGCTGCGGGAAGATGGCC
ACTTCAAAGCGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCTTTCCCCAAGCCCGTCCTCAAAGGGTCGCTGGCAGAAGCCATGATCCCGGGGACAG
GGGAGCGCCGGAAACCAGTAGGGGCGGGGCGCCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACAGGGACTTAGCCC
CTGAGAGTCTTCGCACTCTCGAATCGGCGAAGCGCAGCGGCGGGTTGCTCGTAGTACACGTATGTGTGCGGGGATACGATCATCCCTTTAGAATCTTGAT
CGATTTTGGGGCGTCGAAGAATTTTGCACGCAGCCAGACGGTTGCTCGTAATAGCAACAAGTTGCCCGATGCTTTGAGAGAAAGCAGGGCAACGGGACGG
TGTTAGTGCGACTGGCCGACGGGTGGGTTGTCACTGTCCTCAACGTCCAAGTGGATCTGGCCGTCAAGTTTGAAGACTTTGACAGCCTCAAACAGTTTAC
TGCTCTCGACATGGATCCCTACGATATGATTCTGGGCATGCCCTGGCTTGAGAAGCACGAGCCCTGGATCGACTGGCGAGGCAAGGCAATCGGTGCCAGC
CGCCCTGCGCAGCTCGACAGAGCATTGGTGAGTCATGTTCCCACCTCTGGCAGGACCCGGGGCGCTCGCAAGGGCTGCCAGGGTACCAAAGCATCCGGCA
GATGCTTTGGAGTCGTCGACGTATATGACGACTCCAAGGATGTTTTATGGTGGCAGCGCCCAGAGAAGGCGCTGGCCAAGTGGGTAACTTAGGTCCACAA
GCGGGTAACTTAGTTCCGCAGACAGATGTAGCTGTCACGAAAACTGACAATAGCGTGTTCAGGGTGGGCTACAGAGTTCCACACACGGTAGCCCAGACAT
CAACTGAAGAGGAAGACGTCGGATACGATTCCTGTGTGGGTAACATAGTGCCACACGCGTTCGCCCAGACCTTAACCGAAGAGGAAGGCGTTGGATACGC
TTCCTGTGTGGGTAGCACAGTACCACACGAGGCCACGAGTGCCTCGGATGTCACAGCGCCTACATCCCCAGACGTGGGCAGCAAAGCTCCACGTCACGGT
CGCCGTCGTCAACGACGCCGCCGCCTCAAGAGACTCGGAGTCCAGGGCCCGGGCACCTCCGACAAGGCCGGTGAAAAAGTGATATCACATCTTCGATTGC
GAGACCGGTTTACCCGTCAAGGCATATGGTGTCCACTTGGAGCCATTGCCAGAGGTTGCAGAGATACGGAGCCTCGGGGAAATGACGGTGGAGCCTTTCC
TGGCCAACCGCAAGGCTGGAGAATTTGCTGAGATGGTGTTCATGAGACCTGAGACCACTCGGGAGGAGCTGAACGCCTCCTCTGTCTGGACGAGAACGTC
CTGGAAGACCTAAACAAACAGCGTCAGACGCGCCTGGGTTCTGAGATCCTAAAGAACCCCAAGGATCCGGTGTATCTTTTGGTGACGGAGTATGCGGACG
TGGTGAACAAACACCCGCCGACCCAACTCCCACCGGATCGAGGTGTACGGCATGAGATTGATCTCGTGCCTGGCACAAAGTATTGTGTCACGAGGCAATG
GCTTCTCCCGCGCGAACAGTGCGAGGTCATTGATACCTTCTTCGCCGCGAAAGCGAAGGCAGGCATGGTGCGGTAGTCGAAATCCCCGCACTCGACGCCA
ACTTTCTGCGTTCGGAAGCCGAACGGAAAGAGGCGTCTAGTTCATCCTTATAACAAGCTGAACAACGCAACGGTGCCGGCCCAAACACCAATCCCACGAA
AGGATGTGTTGTTAAACAACATGCCGGAAGCGTACGGTACAGTGCGCTGGAGACGGATACTACCAGATCCTGATGCGAGAGGGCGACATCCCGCTCACCG
CGGTGAGCACTCCAAGCGACATGCTTTGGGAGTGGCTCGTCATGCCGCAGGGCTTGTCTAACGCCCCGGCGACGTTCAATCGCCTGGTGACGCATTTGTT
CCGCCTTTTGCGTACCTTCGTACAGACGTACTTCGACGACATATTCGTCCATAGCCGTGCCGAGGGAGGCAAGACGGCTATGGAGGTGCATCTAGGACTC
CTCCGTCGAGTGTTGGACGTGATGCGAGCGAACAAGCTCTACGCCAACATCGACAAGTGCGTTTTCGCGTCACCAGAGATCAAAGTTCTCGGTTGCTTCG
TAAGCAACGTGGACGTTCGGGCTGACCCAGACAAGGTCAATGCCATAGCAGCATGTCCGACGCCCCGATCCCAGAAGGATCTTCGAAAGTGGTTGGGCTT
GGCCAACTACCTTCACAAGTACAGCGCAGGGTACGCGGGCTTCGCTAAGCCCTTGTCGAGCCTCCTTCAGAAGGACGTCGACTGGCGCTGGGAGCAGGAG
CACCAGGATGCTTTTGACAGCATCAAGGCCAGTCTCCAAGAGGCCCCTGGCCTGGCCCTGCCGGACGAGACGAAGCCGTTTAGCGTCGTCTGCGATGCCT
CCGATTACGCCATCGTATGTGCATTGCTGCAGGCCGACACGGCTGGACATGAACGAGTCATCTCGTTCAAGTCCAGGCAGCTCAAAGCCGCCGAGCGGAA
CTACCCTGTCCACGACAAGGATCTCTTGGCAATGAAATATGCCCTTGTGAAGTTTCGTGTTCACCTTCTGGGCTCTCAGCCCTTCGTGATCTACACAGAT
CACGCATCCTTGAGGACGGCGACTAACTCGCCTCACCTCTTCCAAAGGATGGCGAGGTGGCTGTCCTTCTTCACGGAATACAACTTCCGCGTCGAATACA
AGCCGGGTAAGCTCAACGTGCTTGCGGACGCCCTTTCTCGGCGTCCTGACTATGAGTTGGCCCACATCACACGGGTGACAACGGATCTATATGATCGGAT
ACGCATGGCGTATCGGAACGATGAGGCTGTCGCGCCTATCGTCAAGTTCCTCATGGCAGGAACGAGCGCGAAGTCCGACTGGCTCTCGTCGCGACAGAGC
TCACGGCTCCACCGATATGGGTTGAGGGATGGCCTCCTCTATTACCGGGTGGAGCCCAATGAACCTCCACGGGTGGTCGTACCCAACGACGAGGATCTGA
AGTTCGATATCCTCGCGGAGGCGCACGACGCGCCCTCCAGCGGCCACTTGGGCCGCGAGAAGACCTTTCTGTCGGTCTCTCAGTCCTTCTGGTGGACCCA
CATGTACAAGTGGGTCGCCCGATACGTTAAGACATGTGAAACATGTCAGCGGGTCAAACCCGCAGGGCACTCTTCGGCTCCACTACAGGGCCTGCCCGTA
CCGGCTGACTGTTGGAAGTCGATGAGTCTTGACTTCATCTTTGGGCTTCCCGCCGACGGACACGGCAACACCGAAATTTTGATGTTCGTGTGTCGGCTAA
GCAAGATGGTACATCTTGCTCCGGTTCCCGTCACTGTTACGGGCGAACAAACCGCAAGGTTGTTCGTCGATGGCGTGTTCCGCTATCACGGTCTCCCGGA
GACGATTGTATCGGACCGAGACCCGCGGTTCACGGCTGCGGTTTGGAAAACGCGGTTTCCTTTACTGGGAACTCGTCTGCAGATGTCCACTGCGGACCAT
CCGCAGACAGACGGCCAGACAGAGCGCGTCAATCGAGTGCTCGAGGACACTCTGCGCAGTGTGTGCGCGGCAGCACCACGTACGTGGTCGACGCAGCTTC
CAGTTGTTGAGTTTGTGCTCAACAACGCGGTGCACGCGTCCACGGGGTTCACGCCATTCTACTTGATCGGCTTCCGTCACCCCTTAGTGCCTCTCACTCT
TCGAGGAGACACTGACTCCTCTATTCTAAGTGGGGGAGAGGCTCGGAAAGCCCTTTCCTCCCAGGTCTCGGATGTGAGACCCTTTTCGCTGCGGAAACAA
GTGGAATCCTTTATGGATACCAAGCTGAGCGTTGTCAGCAGGGTCCGCGATGCCATGGCAGCGGCCCAGGATTAACAAAAGGAGTACTCCGACAAACATG
GAAGAGGAAACTTAAGTGTATTTGAAGTGGGGGGCTTAGTACGAGGAACCTACCTCTTGACACTGTCAGCTCTGTCAGCAGCAACAAGCTGAAGCACCGC
TTCATCGGACCATTTGCAGTCCTGGCCAGACATGGTGCGTCGTACACTATCGACCTGCCAAAGTCAATGACGACGCACCCGACGTTCTATGTTGGACGTC
TTAAGCGGTACTTTGATCCGCAGAGGGTTGCTGACTCGCAGACCCACCTTGGACCAGCTCCTCAAAGCGAGGGCGGGCCACAGACGTCGACGAAGGCGTC
GGAGCAGGCGCCCAAGCCTCGGTCTGGACGGCAAAGCTGCGGTCAAGACCGTATGCCGGAGGGGCTCCGTACGAACGGACCCCGGAGCCATACGCCGAGT
ACGCTGAGTACGCCGGGTACGCACCATACGCGTACGTCTGGGAGTGTGCCGCAGGCGGCTCCGGACGTGGCAACAGAGCCTCGATCCGTCGGACCATGCG
AAAGGCCTCGTCCAGATCGGACGAAGAGGCCCGGCGATTCACCCGGAGATGGAGGCTCGCGACCTCACGCTCCAACAGGTCCAGGCGGCCCGCAAGACGA
GCGAGCTCGCCCTGATTCCCGGCCTGGGCGGCAGCATCACCGCCAGTCCCAAGGCCAAGTGCAATCTCAAGCACGAGGACACGTTGACGGAGGAGGTCAA
CCGCGGGGACCTGTGTCGGACCCGCAGTCGAAGCACTCGGACGAGAGTGGCGTTTGGGAGGCGCCGAGTACTCGTACTCGTACGAAGGCACCTCTGCCCC
TGCTTGACCGGAATGGAGAACCCACTTCCACGTGGAGCGGATCCTCCAGGAGCAACGGCGTCGCGGTAAGCGACAGCTCCTCGTGAAGTGGAGGGGTTAT
GCCCACTCCGAGAAATCGTGGGAGCCGATTGAACGGCTCCTGATTGACTGCCCGAAGGCTGTCGCAATCTGGGAACAGAAGCAGCGGTAGCTTCATAAGT
AGTCCAGGGCTTCTTGCCCGAACGGGGTACGGACGTTGAATACACTCCGTACCCGCGCTCATCGTGAGCACTGGAAGCATCGCGCTTCAGGATGTCCCTT
GGCAGCATGCGCTTGCTGACCAAATGGGCAAACCTAACACGAAGATCACGCTGGTCAGGATGCGGGACAGCAGCTGATCTTCATGGAGTTCCTGTAACTC
CGTGGGTGAGTACTTAAGAGACTCCACCCATGCCTAGAACATGTCCTCACAAGAACTCCAGGTGGGACAGTTCTCGGGCATAAACCAGGGGTGTCCCCAA
AAAGGATAGAGACCACCCCGGGTCTCGGGCTTCCTACGACAAGTCGTGAAGTCCTTAAGGGGGATGCGGTGGCGCGAGAAGCACACACCGAGCAGCCTCC
AAGTTGTCAACGACAAATGTTCCTTCTGAACAAGGGCACGTTCGTAAATGCCCCTAGAAGTGTGGCCGCCCACAAGGCCACGAGGAGCGACGAGAAGCTC
TAAGAAGAAGTCAGCCCCAGATCTCTCCTCGGGAGGCCAATACTTGAGTTGACGACAGCTCCCTGGCTGACGGGGCCACCACCGAACCCCCACGCACACG
CTGGGCAGCTTGGAAATCCTCCTGCTGCTGGTCGAGGTCATTCATGACCTCCCGGGGCTCAGAGATAGCACCCTCCTCCTCCTCCTCTTCCCCTTCTCCT
CCTCTTCATCCGAGGAGTCGAAGATTCTCCGATGGGAGTACCGAGTCTCCTTCTCCTCGCGGAGTGGAGACTTCGAGGTTGTACGCTTCTTTGAGGGCTT
GGGCGCCTTCGGCTTTAGAGGCCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTTGCGAGGATTCTCTTCCTCATCGCCACCAGCTTGGGAGTG
CCCTTAGCCTTGACGGCCGGACTCTCAGAGCGCACATACGTCATGGGACTGTGATCACCTTGATCACTTGCGAGCGACTGCACGCTGTCGTCCTTGTGCT
CGCTGGGCACTGGGCGGTGCCCTCCCACAGAGCCCGCAGGAGCATCGTGCGTGCTCTCGGACTCGGCTTCGTCCTCACTGCCAGAGTCGAACTGACGTTC
TACGAACCAAGGGTTCGAACGATTGTCTGGGGAGGCCGAGGGCGACGGGCTGCGGCGCTTGCTTGCTCGCTTGCCCACAGCCGCGTCACCCGAGGAAGCG
ATTGCCTCGGATGCCACCTGAGTAGCCTCCTCAAGTGCCGAGCCTTTGCCGTGAGGCTTAGGGCTCTTGGCTTGCGCCTTACCGGCAGCAGCCTTGGAGC
GTGTCTTCGCACCGCTTTTTGCTGTGCCACGAGGCATGGTAAACGGTCGAAGTGGAGATCTCGAAGAAGAGCGCACAGATTGCTGCTCGGGGCTCTATCT
GTGAAGTGAACCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCGACTTTGAGAATGAAAGTTTGTGACGAACACCTCTTCATTCTGATTGGTCGGT
AAGCCGAACCGAAGTGGGGGAGGATGTAGCGGGGTACGTAGCCCTAAGTGTACCCTGGTTACATGAAGTGTGACACGTCATACTTCGGGATATTTGGTAC
AAAGT