Description :
From Genome Similarity Track
Location :
Scaffold_1:3908047- 3915671
Sequence
7624 bases(100 bases per row)
ATGCTGCAGGATTGGCGTCGTTGTGCAACAAATGGGATAATTCTTCTGCTCCTTTTCTAATGAAGCAAAGATACCGACAGATTCACCACTTTATTCAGAA
GCGAATGCGCTGTAGCCAAAACGAGAAAATCTGCTTGAATTGGAGAGCACGAAACGCTACGCGCTGGAAGGACGAAATGTGTGGTGACTTCGAATTGTCA
AATGAAAGACAAACATTACAGGGCGACTCATTAGATCCCGAGGCAAATGGAGTTTTATCGGGAGATGTAGACTACATGTACTGGTTGACAAGGGCCACTG
CATTAGGAAATCCTGCGCACCGCTACAGCAATGAGGCTGTACAATCGACTTTTTGGTCCGTCATGGGACGTGAAGACAATGATCAGCAACCAAGGACGGA
TAGTAATAGGCTTTTACACGCCTCTGTGCTGAACGCTAACGTGTATCAGTCCGACAATAACGCAGTAAATTGTCTGCCACAAACAAGTCTCGGGATAATT
GCGCGGCGAATTCAAAAAATGCCGTCACGTAATCATACTTCCAATGCGTCTATGGTTTTGTCGGGTGGCGGAGATGGTGACAGCTCGGGAATTAGTGATC
CTCTGGTATTAAATGCCCCAATGCCGACAGTATCAGCTGGAACAGCCTCATGTGAACAACAAGAAATTATAGACTGGATTTTATCGAGCTTGGACAAACC
GACTCCGAAGCAAACTCTTACACTAATGAACGGAGGGGCTGGAACTGGATAATCGTTCATGATTTATAAATTGCAAGAAGAACTACGAATTCGAGGATTG
AAAACGGTGATTACGTGTCCGACAGGAGCAGCCGCAAGTCAATTTCCTGGAGGACAAACCTGCCATGCTGCATTTAAGGTGGGCCGAGATGGAAATCGTA
TCTCAGCGTCCAAACTTTTCGATAGTACGGTGGGCCTTATCGTGACAGATGAAATTTCGATGCTCGGTGGCGAATTTGCAGTAAAAATGGATAAGCGCTT
ACGGCTTGTGTATGACCCTGATCTTCCCTTTGGTGGGAAATCGTTACTTTTGGTACGTACAATAGAAATCCTTACTTGTCACGGACTGCTAATGTTTTAT
CATCTCTTGCTGGTTACTATTAGTCCGGAGATTTTTGGCAACTAGAAGCTCTTATGGGAACACCACTATGCAAAACGATGTACAAACCCGGTCTCAGTGA
AGTGCTGACTCATGCACGTGATTTGTTCAGACGATTTCGCGTCTTCTTTGTCGAGACTCAGCAAAGGGCCCACGACTGCCCGGTGCAACAAAAAGTCTTG
AGAGCTTTCCGATCTCTACCTGCAACATATCCGGATGGATTAAAAATGCCCAAGAACTTCCGACCATTAAATGATGATGTCATTAGTGCTTTAACTCACG
AGCTGACAAAAGAAGAAGTGGAAAGGGACCCTGAATGGATGGACGAAACTACAATTTTGGTTACGAGTAACGTAGCTGAGAACACCCTAACTTCGTGTTC
CGCTAAACTACTAGCAACCCGTACAAATTCGGTCGTTTTCCGCTGAAGAAAAACAATTTTTGATGTGCCTCAAGGTTGGTCTACAATGATAAAGATTATC
CAAACCTCTTTGGGTATTTTGGGAAAGGTGGAAATTCTCAAATTCTTGATAATGGGAATGAAAATGTAGAATGGGAAGTTGCAAATGGAACAATGTGTAA
GATGGTTTCTTTGGCCTGGACAAAACCGGAAAATACCGAAGCCGTATTGGACTACTTGAATACTATCTCGGCACATGCGGGGGATGTTATTGATCTTCCT
TACGGACCTGACTATGTAAATGTACAATTGGTTACGCTACAAGGAGACGTTGTACCCGCAACGACATGGCCACCTCAAAACAACCTGGAGACGAATTGGA
TACTTGACAAAACTGGTCGAAAAACACAAAAGTTCAGCATCATTATACCTATTGGTCTCGTTAAAGAAAAATACACCGTCAAACTAGCGCGGACACTTAT
CCAGAAACAAATTGAAATAAATACGAGCAGGTTGCAGTGGAGTTAGCGCTGGTAATGACGATATGGAAAGCACAGGGAGCAACACTTCGACGAGTGTTAT
TGTACTTGGAAGGAATACCTGGTGCACCTAAGTGGCTTTTTGACCACATCTACGCTGGAACCTCGCGCGTACGACTTACCCGATTGCTTCGGTGTCTTCC
TCCATCACCTGGATTTAGGAAAAACGTCTTGAAAGAGCTACAGCCCAATCTGTATACCACTAAGTGGGTCATGGACATTGGGGAAGATGGCTATTGGCGA
CTTCACAAACAATCGAATTAATTTTCCGACAGTCAATTCAATAAAATGCTAGGTAGTTTGCTGCAACACTCTGCCCAACATTTGCGTAGTTTATGATCAG
AGTCGGAAATGAATGTTGAGGTGGGTGATTGTTCTTCTTAGTGGTACTCTTCCGAAATCCACGTAATGAAATTAACTGCATCAGCTCCAGCTAGATACAG
GGCTTCACTAATATATGGGTGGGGTCCGCGCCCAATTGTTAGAGCTCCGATCATAAGAGCAACACTGTGAGACCGTTCACCATACGCATTCTCCATTTGC
CATTGTAACACAGTGTTTTCACTCTCTGCAAGCTCCGAAAATACGTGAAGAAATGCCGCAGCATGGTTGTCAGGAGTAATACGACTTACAATGTCGTAAA
TACGACAAAAAAATTGACCCCAAGCCAGACAATCCAACATAAATCCTCGAAAAAAAGACCATTGAAACTCCAAGGACTCTGCTAACGCAAATTCTCCTTC
AATTTCCAAATCTGGTTCATATTCAAGGTGGTACCACGTGCCAATATTGGCATAAGGTGGGATACGCTCCAAAAGACAAATAGACAGCGATCGTCCTCTT
GAAACAGTAATACCACACCCATCGAGCCATTGGTTAAGAAGAGCCACTGGATTTACTCCAAGCAAACGTAGTAGGACCTCATCTGTTCGCTTAGGTGCCA
CGGAATCCGATGTAGGATTATATTGAGGAAGGCAACCATCACGCGAAAGGCACCCCCTGTCGATTCGTTGTCGGAACATTCTGGGTCACGGAGGCAAAAA
GTAAAAGAAAAACTGGTGAAAACATCTGCCACGAAAATTAGATAGAATTGGACGTAAGCCTTTTGTTGAGCACTAACGGAAAGAACCACTGAAATATATT
CTGAGAAAAAGCCGTCCTACCTAACGACCGAGTCTGTCCGATCCCACTCCTTACGACGACAGATATTCTTTTGTTGGAGCCACCTGATTTCCCACTAACC
AAAGTGCACGGGGTCAACTAAGCCGCTTACAGCAGCATGGACTTCAAAGATATCTCAGTCCCTAAAAACTACAAGTCGCCTCTGCAGCGTCGAGACGAAA
GACCTAACGACGCAAACTACCGCGTGCTTGCCACATCGGATGATAAGACTACACTACTGACGATATGTATCATGACCACACTAGGAGACTTACGTTTGCT
TCTTGTGCGTGTAGCGCTCAAAGAATTTGTTGCCGAGAAACCCACAACTACTGAGAATGTCCAGATTTTCGCACGATTCATTTGGAGTAGTGCACACACG
GTGAAAGACGGGAGACGCCTTCTTCGCCTTCATTTAACTGACTTTTTTGCTGATGAGTCTTCGGAAACGCTCTTGCAAGTAAGTAACATTCATTTTTATT
AAATGATTAAACTAACCCATACTGATTTCAGCGATACAAGGACAACTACGAACACAACCAATACGGCGTTGATCAAGACCTCATCACAGCAACTATCTTT
GATGCAGAAAAAAATATGGAAGGTCTACCAGCTGCTGGACAAAAGGTTAGATTTACGCGATTCTGGAGCCCTAAACTGTACCGCGAAACATGTTGCCAGT
TCACTGCAAAGATCGAGAACCTAGTCTTTCATGGGAACGATACTAATGCGTCCTCCACTACAAACGATCACACGGATTTACCTGGCCAATCAGAGATCGA
TTCTGATGTTGTCAAAGTAGAGACCACTCCAAGTTCCCCCGTGGCTCCCAGAAAAAAAAATCTGAAGAGAGATACTGCTGCTATTACGAAATCGGACTGC
ATGAATGGTACGCCTGATGTCCACAACAAGACGCCCAAGCCAGCTTGAAGAGTTTTTCGTCAGTCTATCTACCAGTGGTTGCGTGCACTCATCATGTAGC
ACGGGTACACCGTATTGTACCCCACTCCCCCCCCCCCACACACACACATTTTACTGAGAATCACCTGATTCTCCAATTACAACTGATTCTTCACTCAGAA
CTGAGAGAATTAATACACCCAAGGGTGAATTCTCACACTGAGCAACCAAGAGGCTGTCGCGGCTCTCCGTCACACTAACAGTGACTTATGTAGAATAACG
TAAGTCGCATATGCATTAGTTCATTCTGGGTGTTGAGCTGTGACCTCCTAGGGTGAGTTGCACCTGTCGAGTTTCTGTGACTTAGAGCGACCATAGCTCA
ACAATGCTCCCTTGAAGCGCAATGACCGTGCTCAAATTGTCGGATCATAAGCAGGTGTACGCATTCACATGTATTATTGACGTGGCTTCTAATTACCCAA
AATCACGCAACTTCTGATTGCAACACACGCACCTTAAAATGTAGGCGAGTTTGTATGCTTCCATATATTATTCAAAACTTACATGATAGTTTTTGTAGAA
TTAATGCCTCTTCTAGATGCACCCGGACATGTCGGCATTTTTAACCCAACGATATTTTGCGCTCTACTCGAAATTGCCGCGCTCGGTTCTTTGTTTGAGC
GCGCACGCAATAACGTAAGTCGTTATAATTACATAATGTATATATTACCAAAGGTAAAATGTGTTGAATACACCACACTCCATTTTGCCGGGAAGGAGAA
CATGGCCGACGCCGAGGGCATGATGGCCTTCGAAGCTGACCAAGGTGTGGCCGGTTCTCCTACCAGCCGAAGAGAGAGCACGTCGAGTGTATCTCCTCTG
ACAGGTGATGCCAGATGACCACACGAGAGACGCCTCCTTCGCCTTCGTCGCCAGCAGCGCGTGTGTCACCTTGTCGAATGCTAGCAAGCCTTCGAGACCT
TTCGTGTATAAAGCAGTGTAGCTCAGCTGTAAAACAAACAGAAAATTCAACACAAAACTCGGTTATGTTTAAAAAAGAAAGCGCAAGCTCTAACTTAGCT
CATCTGACTGAGTCTAATCTCATGCTTCGTTGATTGCTGTCCCCAGAGCTGGCTTCTTAAAGTCACGTTTCTTGGGATCAAGCTTATCAGCAGCCACTTA
GGCAAATGAGGATGCTGATCACCGCGCTAGATAGAGTGAGGGAAAGAGCGCCGTACATACGTACTGTGGGGTGTTGAGCGCCTTGTGGCCTACGTGCACT
TGGTGTTCTTGCGCTTCTTCTTGGTGGCGTCGGCCTTGTCCGTCTCTGGGCGAATGAACCTCTGGCCGCAGATATTATGATAGCTTTGACCTGCAGCTGC
AAGAAAAGCCATTTTGGACCAATGGAAAGAAGGTGCGCGATATGATCGCAGTGGCAAACTTGACTAGCACTGGCTATTTCTCCGTACGATTTGTCGTTCA
CCTCTGTAGCAAACAAAATTAGTCAAACACTAAGTCAAACAAACCTGCATATGCACTTTAAGACTTTGAATAATCAGCTGGTTTGAAGAGGTTAAGACTA
GCGCTATGAACGGATTAAAAAGGATACTGAAATCAAAGTTAAATCCATTATTTGTACTACATAACCCTCCAATTTTGCGTCCTAAAGACGCCTCGGAGAA
CAATATGCTTGGTCTGTACGTTTTCGGCCTCATCAATGATATCTGGATCCACAGCAATCTTGATCGGCTTCCTTGAAGTCACTCTCGACAACGCCAAATA
TAGCTGTCTATGTGCGAGTACTCGTGATTTCAAATAAGATACCCACGTGGTGGATCAGGTATTTTTAGAACTTGTTAGTCGTCATGGCAAGCGCTGGAAC
CGCCGGGCTACTTATACTTGAGTTTGAACGGGAACGCCTAGTCATCCTCCTCACTATAACAATTCAAAGAATGAGCCCCCGCCTTACCTTTAAACGGCCC
AGACGCAATGCTGGTCTCGACGCCCCACTCGCGCATCGACACAGCCGAAAGTCGCGCTCCGCTGCAAAGTTCCGCGTCGCTATACAGGTTTTAAATTTTG
ACGATAGGCTCAAATCTTCAGAACAATCCGGTGCCAAGGAGGGGGGTTCCGGAGAAGTTAAAAGAGTTAAAGATTTCCTGCTTAAACCTATTTGCATGCG
CAACGCCTTCGATTTTGATCACCGAAAGGTTTTGCTCCGTTTTACCAGACAGTCGCTCAACAACCATGTCGCTGATATGCCGAACAATTTCATATGCTGG
GGCTAATGTGGCTCGCTCGACGAAGTATTATTCGGGTAATTTTCGGCATCAACGCCAGGGTGCATTGTTTAAGATAACATCACAGGTACTACATAGGGCT
GCGGTGGATAGGCCAGCCAGTGCTAGATGAACATCGATCTCTATTCGCACGTAGTGCGCGCAAAATAGAGCGGATATCCCGGATTGGAGTTCTGGGCCAA
ATTCGGGCAGGGGGACTTTGAACAGTCGTAAACGAAATCTCGGTCAGCTTCTCCCAAACGTAAGACAACAGCTGTGCGAGCTACGATGTACGCTTCTAGT
AGTCCTCGCCGATGAAGACCAGATGCACGATCTTTCAGAATTGTAGGACACTGAGGATGCAGCGAGGGCCGCGTAAACGCCATCGAGCGGTGACTGGAGC
ACGCGAGCTACTGAGTAGGGAGTAGTTTCATCTTCAGCTGGCAGATATATGTCCGGTTGAGCTTCTCAACAGGATTGGTTATAGTAATGAAGCCGGATAG
AGTGTCACATAGTAAACTTGTATTTTGAAATCACCACGCCGTCACGTACACGCTACAACCTCAAATTTCAGTCAACTCATATGGCATACCGGTGGTTTGG
GCATTGAACGCAACGTCGTCTCGGGAGAAGTGGACATCATATAGACCGCGAAACATTAGAGCCCAATGCTCGCCACTAAGCGCTTGTGCTTTCTCACGTG
GTGTTGCGACCAGGTTAAGAAAGTAGTTATCGGAATCGTGTGGGGCTATCTTAGCATCACTCATCACATACTTTACAGTCATCTCAGCTCCATTTACGCG
AGCATACATGCGTCTTAACGTAAGAAGTGAGGCACCGTAGTGACCACCTCAAAGCTGTGATGTGGTAAATAGATAAACGTCCGAGAGAAATCCGTATTCC
TGCAAACGTGCTCCGGGTACATTTGAATTTCATCTTGAATGATTCGTCAGTTCAGAACAAAGGTATCTAATTTCCTCACGGCTTAGCGTTGGAATGCCTT
CGTGACACGCCTACCAGAAACGGCTGGGGCATTCGACCCACTCCCGACCTCGGTCAAATCTGACTCGCCATAGTCGTTAGCGAGCGTGAAGACGCGGTGC
TCGCCTGCATACCTGCGAAATGCAGAGGTACGGTCTCTGCGGCTGCCAAAGAGGGAGTGTCAGTAATGGTGCTCAAAGTCTGCACCAGCTGAGACGACAA
GGTCAAACTTTTGGCCAACGGTAT