Description :
From Genome Similarity Track
Location :
Scaffold_419:39078- 46010
Transcript NameFunction/comments
Aphin_H310_00849beta-glucosidase

Sequence
6932 bases(100 bases per row)
TCTGTCGTACAACTCGGTCGCGACGTCTCAGTTGGCATCCAGTACAACGGAGACTGCTGTGAAGACCGCATTGGAGCTGCTGCCTGGAATCGGTAGCGTC
AAAGTGATTCGATCCGGCCCGGATTTCCAGCTCGGGTACACCTGGACAATTTCGTTTCTGACGTTGAAAGGACCGGTGCCAGCGCTCGGCTACACAACCA
GCACTCTTACCGAGTCTCGCAGCGACGGCGTCGTGTCCAAAGCGATTACAGTCGTGCGCACCCGTCCTGGAACGACACAAGCCGTACAAACGTTGACAAC
ATCAACGTCCTTGACGAATGTACCCCAGTCGAGCATGTTTCAACTCCAATTCACAAACAACGGGGTCACTACCACGACGGGAAACATTCCAGCCAACCCC
ATGGGTGACGGGACGTGCATGGCAACGCTGACGGAGATCCAACGCATCAAGACGACCACGGTCGACACCACCAACATGGGCGGAGACAACATCGCATCCT
CTCAAATGTTTTTTCAGCTCGTGTTTACCTCGAACGGAGTGACGCAAACTACAAATCGTATCTTTGCCAACCCCAGCGCTGGCAATTGTGCCGTCGGCGC
AACCTCGATCAAGGCGGAGCTGGAAAAATTGCCAGGAGTTGTGGCCCCCGTGACCGTCTCGAACATCGCCACCGTAGCGACCCAAACGTGTCAGTGGGAT
GTTACGTTCACCAACAATGCGGGCAACTTGAACCAAATGACCGCAGTGTCGGGTGCAATTGGTCCTGCCAGTGCCATCACGATCGGCGACGATACCGTCA
CAATAACGACCGTCCAAGACGGAACGGTTCAAATCATCAAGTCTGAATTGGAAAAGCTCGCCAATGTGGCGTCGGTCACTGTCACGGCCGTTGCGGGACT
CAAGCAAACGTGCACGTGGAGTGTCACGTTCGACAACAACGCTGGAAATTTGGCGTTGCTACAAGTGGCCATGGGCGGTGCATTTGGGAATTCTGCCACC
GCCGCAAGCACGACCGTCACGGCTGCCCTCCTCACGACTGGGACATCCGTGCCGTTGGGGGGATTCTTTTCGCTGCAATTTCGGGGTCAATCCACGGGGT
ATCTACCGTACAACATCGCGGCAGCGGACATGAAAAATGCGCTCGAGCTGCTGTCGACTGTTGACGGCGTGAGCGTTGCGCGGTCCAATGTTGACCCGAA
TGGCGGGTACTCTTGGGCGATTTCATTTGTCAACAATCTGGGCAACTTACCTCCGATCACAGCAGACTTTGCAGCGCTGACAGGCACTGTGCCGACCGTG
ACCATCACGGAGACGATACCGGGCATTCCCCCGCCGTTCAATTCGCGAGATGTTGCGAACGGTACTGTTGTTGTCCAGTGCATGCAGTTCTCACACACGG
CGGAACCTAGGAGTGCCATTTGGTAGCACATTCATCGCAGACTTGAGCTCGCTGTCGGCAACTCTGCCGAAACTGGATACGAACATCCCGTACTACGTTC
GTGTGACGGCCCTCAACGCCATCGGCCGCAGTGTGCCGCAAATGGCGACGCCAAATTTTGCCATCCCTGCTGCTCGTACGTTGAAGCAATCGCGGTCACT
GCATGAACCGTCCTCTTATCGTTGCCATAGAGCCTCCTCGTGGCCCGCAGAACGTCACGTTGTCTGTGTTGGACCAAACGTCGCTCCAAGTATCGCTGGG
CCTTCCTCCGTCAGACGGCGGCCTCCCAGTCGACGCGTACCGAGTTGAGTGGGACACCCAACAAATTGTGGACGAAGTACAGAGCGTCGTGCTCACAGTG
CCGGTGGTGAATGAAGTCCAGACGATCACGACTGCAGCCGCCATTGTGAGTGAAGTTCAACTCGTTCGCCTCGTCAGCACATACGTTGGACCAGCTGCAA
CCGAAGTCCAGCGCGTGAACTGCGATGCGTCTGGGGGATCGTTTACATTGGCATTTCTTGGTGCCACGACAGCTCCGATCTTGGCAAGCGAGACTTCTGT
GGCTGTGATCAAAGCCACTTTGCAGGAGTTGGTGGGAGTCACAGTGTCTGTCGCGTTTGTGGGTGGGGCCACGCAGGTATGCGCCCCATGCCCTGTGTCT
GGATGTGTTGGCGGATTTGCTATCACGTTTACGTCCGTTGTGGGGTACGCTGGAGATTTGCCACTTCTTACAGCCAACACAACACTCTTGACGGGGAATC
GTCGCATCGACATTACAAAAACGACCGTTGGCCAAGCTCCACCGGGCGGAACCTTTTCTTTGGTGTACAACCGAGGGTCCGACACAGTAACAGCCCCAAT
CCAGGCAACCGCAAGTGCGGCAGCGGTGCAAACAGCATTGCAAGCTCTCGAAGCTGGGTTGACAATTGCCGTGACGGACGGAACGTCGAGTCTACCTGCC
ACAAACATTGCTGCGGGGGAACGACTGTGGCGCATCACGTTTCAAAACAGTGGCGACGTTCCAACTCTTCGTTTGGCCAACAACCTCCTCACTGGCAACG
GCGCCACTATCCAGGTGTATGCCGACGGCGCCACGTTGGGCGCCATCGCCCCGTCCGTGCGAGGAAATCAAGTGTATGGTCAATTCACGCTCAACGTCAT
GGGTCGCGTCACGGACTGGATCCCGTTCGACGCATCCGACACAACAATGAAGCAGCGGTTGGAGAGCCTGCCAAACTTGGGCACGGTGACTGTGGTTCGC
ACGGGCCCAACGCTCCAAATGGGCTACGTCTGGACGGTGACGTTTTCCTCCAACCCAGGCAATTTCCCCTACGGCGCCGGTTCCCTGTTGCTCATGACGC
CCACCAATACGTCGTTCCTCACTGGCACAAGTACTTCCGCAACTGTCACCCCAAGTCGCGTCACGACGGGGTCGGCGTCGGTGGGTGGAGCGTTTTCCCT
TTGCTACTCGTCGCTGTGCACGAGTGCGCTGAGTCCATACCTGTCTGCATCCGCCCTCAAAAGTGCTTTGGAATCGATCAACTCTATTGGACGCGTCAGC
GTGTCGCGCACACAGAACGTCGATGGCTTTACGTGGCTCGTTTCGTTTGTGGGTTGTCGCGTCTTGGCCGATCAAGTCACGAACGTTTGCAACACTGGCA
ACCTCAGCCCCCTCGTGCCCCAGTTTGTCGGCACGCTGACGGGCGGTGTTGCGAATAACGCGGTCGTGACCGTGACGGAAGTCACGCCTGGGTCTGGCCC
AGCCAACGTCCGTGACCTGACCGACTTGTCGGGTGGGGTACCTCTCGTGACAAGTCTGCAAGGTTTGTCGACGGGACGTTCGTATTTCGCCCGCGCCAGC
TTTCGAAACGCGCTCGGCCATGGGGTGCGAGTGTACACGACCCCTCCATCACTCGCTCCTCAAGCCACAGCACCAGGAAAACCAGACCCTGTGGTCCTCG
TTTCGAGCACCGCCACGTCGATGCAAGTATCGTGGTCCTTGCCGCTTGTAAATGGCGGATCGCCTGTGACCGGGTATGAGCTGTGGCTGTCGGATTGGAA
CGACAACTACCGGCTAGTGTACGACGGGGCCAACAGTCTCGCCACAACGTACACGCTCGTGACAACGAACGACAACGAAATCAGCACAGGACAGCAATAC
TCGGTCAAAGTTCGTGCGATCACGTACTGCCAGCCGGCAAATCCATCGGCAGCTTGTTTTGGAAGCTTTAGCGATGCAGCTACGTACACGGTCCGTGCAC
CTGTGATTCCTACAGCCCCTGCTGCACCCACGCGCGACTCCAAGACGAACATTGGGCTGCCCCTTGTTCAAGGAGATGGCACGATCTTCATCAACTGGAA
AGCACCTGCGGACAACGGCGGATCGCCCATTACAGATTACCAGGTCTACATGGACGCCGGGGCTGGCTTTGTCGTGCAAACGCTGACTGGGACATTTCCA
TACGGGTTTACAACGTCGGTGGGGTCGCTCATGGAAGGAAACATGTATCGGTTTTACGTGCGGGCGCTGAACTCCGTGGGGTACTCTGCCAACAGCCCGA
TCTTGACGGTCACGATGGCATATTCGCCGAATGCTCCAGCTGCTCCCGTGGTCGCGGATGTGTCACCAACATCCATTTCTCTGACGTGGGCTCCGCCTGC
GCTGTGCACGTCGAGCCAAACGTCATGCAGCGGTTCGCCGTTGACAGGATACCTGCTATGGCAATTCAGTGGCGTGAACTCAGCGTTGCTGTCGTCTCCC
ACACCAGTGCTCAATGAAGTGCAGCAGATCGCCATCAACGTTCTGCCTCCCGCTACCGAAGTCCAAACGTTTACCATCACTGGGGCGACGGGCAAATTCA
AGCTCAACATGAACGGCAAGGATACACCGTTGTTGGACGTGGCGATTTCGAACACGCTGCTGACCACTCAAATCGCCACGACGGGGCTTACAGTTGCGGT
GAGTCAAGTTGCGGTCACGGGTGGCATCACGTGGACGGTGTCGTATACGGGGACTGCAGGACCTGTTCCGATGCTTATTGTCGTGCCCGAGCAACTCGCC
AATGCAGTTGCATCTGTTGCGTATTCGTATTCCACGGCTCGGGTCACGGCCGGTATCACTGTCGCGGGCGGCGACTTCACCTTGTCATTCCGTGGATACA
GAACTCCGAATTTGGCTTTCAATACCCCTTGGGTGGAATTGAAGCGTCACTTGGAGAACTTACCCAGCATTACGCATGTCGCTGGCTCGTACACTGCTGG
GTCCAACGGCGCAGGCACTTGGTTGGTGACGTTCCAGACAGAGCTTGGCAACGTTCCATTTATCGAGGTCACGTCGGGTCGGCTGACGGGTGGTGGCGCC
ACTGGAGTGGTCACAGTCATTCAGGAAGGCACTCCGGGGCAAGCCATCTACGACGGCACCAACGCACCGGACGTGCTGAGCTACCAAGCGGCCAACTTGA
CAACTGATACGTGGTATTCGTATGCAGTCGTCGCGATTAACGCGGCAGGGGCGGGAATTGCCAGTCCAACCACTCCATCGATTGACGCTCGTGGGGGAGC
AAGTCCTGCGACAACAACTGCTTCCGGTACTGCGCTGAGTGTTGGCATTGCCGGCGTCGTGTACGAAGTCCAAACAGTGACCACGAATGGTCTCGGCGCC
GGAACGTTCACACTGAAGTTCGGCACTCTGGCTGCAACGGGTCCCATTTCCGTGACAACAAGCGCGGACGTTTTGATTACACTGCTGCAAGCCACGAACA
TGGGCACAGTCCACGTTACGAAAATGCCTGTCAATGGTGTTGCTGACTCGATGTGGTACATTACGTTCCGAGATTACGTGGGCAATGCTCCGATGCTTGT
GAGCAGCAGTGCATCCGTCACAGTGTCCGAGTTCATTCAAGGCCGTGCCAACCAGTTTACAATTGAGCCCAAGAAAGCGTCTGGGAACGTCGTGACCGAT
TTGGACGCTGCATCGGGGTTTGTCGGGAGCGACACATTCTTCACGGAATTGTGGTCGAGCCCCGCCAATGTGCTGGACGGGACCCACGCGTGGGTGGCCG
ACGGCGGCGTCGCCACGTACAACCCCGCTACGTACGAAATCCAAAGCATCACAATCACAGCACCGACGGGGCTGTTCACGGTAAAGCTAGACATGTCCAC
GGCGCGATTGAGTGGGGTCGTTTCAACGTCGACGGTCACCTTGAACGCTGCTACGCTTTCGACGGCCACGGATGTCAATGCTGCGTTCTCGTTTAAAGGA
TGCGTCGAAGGCTTGACCAACGCAGGGACTGTTCTCGTCACCCGAGTCACCAACAGTGCTTCGTCGTGGACGTACACTGTGACGTTTGTGACAGTGCTGG
GAGACATTCCTTCGATGATGCTCGTCAGCTCCGACGCGACATTTACAACTCCACAAGCTGGCGTGTTGACGTTCACCGAGGTGGCCAAGGGGGCGACGGA
AATCCAGACTGTGACGGTGGCTGGAGACACAGCTTTTGTCCAAGAAGTCCAAAGTATCTCGACGTGGTTGGATGCAACGGGCGGAGTAACCACAATTGGA
GGGACGTTTGCCGTGTCGTGGGCGGGCGCACCTCCGGTGACTGTCGCCGTATCTGCCACGACAACCCAAATGCAAACTGCATTGCAATCCCTGCCAAACC
TTGGCACGGTCACTGTGACGTCGCAAAGCGTCAACTACGGAGGCTCGACCGGGCTTACAACGTGGTTCATCACGTTCACGACCCTCGTTGGTGACGTTCC
GTCACTCCAACTCACGGCCAAGACACTCACGGGAACGTCCGCCAACGTGTTTGTGAATGAAGTCGTGAAAGGGCAGTCCCCCCTGGCGGGATCGTTTGTC
TTGAACTTTATCGACCAAACGACGTTGAACTTGCCGTACGATGTGTCGGCACTGCAGCTGAAGACGGAACTGGAAAAACTACCAAGCATTAGCCAAGTCG
ACGTGGCCCGTGCCAACATAAATGTGGGGTTCAAGTGGACGATATCGTTCACACGGAACGTAGGGAACTTGCCGCTGCTTCAAGCATTTCCACATCAGTA
CCAAGTGCAGTCCGTCACGACAGGGGGCGGCAATCCAACACCACTCTATGGCACGTTCACGTTGAGTTTTCTTGGCCAAGAATCTGCCCCCATTTCGTAT
GACGCCAGTGCGAAAGACGTCAAAGCTGCTTTGGAAGCGCTGACTTCCGTGGGGCGCGTCGACGTCACACGTAGCAATTTACTGAGCCCAGGTGGACAGT
TCCAGTGGCTTGTGACGTTCCGGACTGAGCTGGGTCCGAACGCCTTACTCGTGGCAAGCAGCCAGAAGTTGCTCGGGAGCTCCTCAAGTGTGACCGTGGC
GGAAGTGCAATCCGGTTTGCTCAAGGCACTGACTGGCAACAATCCTGTCCTCACTGTCGAAAAGAAACTGCGAGGCACGCCGAGCTACACTGGAAACTAC
GTCCCAGCCCTACCTGGCTCGTATGCGTTGGC