Description :
From Genome Similarity Track
Location :
contig_20:390775- 391929
Transcript NameFunction/comments
g5267.t1hypothetical protein

Sequence
1154 bases(100 bases per row)
CGCGGGAGCAACAGCGGATTGATAGGGGGAATCGTTTCTCCCGCTCTAGCTTCACCTTCTTCATGTGGCACGGCTTGTAGTTGTTATCACCGCCCTGGTT
AATACAATCGTCCATTGACCCCTGCAAACTCAAACACGTTGCATTGATTGATCGTATTGGCAGTTCCCAGTACGACTCGGTGACTGCAGTAACCAACTCA
TCGATCGTGCGGGCGTTCTTTTTCCGCTGTCGCGCTTGAATTGCTGCAAAAAGCCCAAGATTATTGCAATTGAGATCTGGGCTGTTCGGCGGTTGGGTGC
GCAGCACCACACGACGACCACATGCAGCACCTGCATCTCAACAAACGCTTGATCACCTGAAGCAATGTGAGCAGGCGCATTGTCTTGCTGGACGATAATT
GGCTTATCATCAATGTCTGCAGGCCAACGCTCACACAAAACAGGCAGCAAATTAGCGATCAGCATGGCCCCATAGCCCTTTTTGGTCACGAACATGTCCT
TCGTGATGATCGTCCCCGCTGGACGACGCACTGAGAATCGCTGGGCTGGCACGCGCTCAACGAAGGGCCAAATGCTCAGCTTTCTGTCGAAGACCTGTTA
TGTTACGGGGTCGAAGCGCGGGCGGCCAACCGCAGCCAAGAACATCACCTTAGTGATGTAGCGCTTGTTGCGAAGTCGTCGAACAGGCGCCTCTTCGTCA
GGCAGGAGCAGGAAGCGTCGGGTCGGCTGAGTGATGTAAAATAGTTTTTCGTCTACGGGGACGGTGTCGAACATCTTGTTGTACAGATCGGCGAGGGCTT
GGTTGCGCTCGGCATCAGTTAGGTTGGTCTTGCGAGCGGGGACTGACTTTTCCATGGTAATTGGTGATCTTTAGGCGAGGACGGGCGAAATTACATTTGA
GAATCTATGTTCCGGCCAGCGATGGCATGCCAGCGCTACTCAACCAACCGTTGTGTAACAAATACTGAGCTCTACAGACAACTGAGTATACCAAACTACT
GGCGGCAACGAGTCGCGTGTTTTGATTCAGACTATAGCATCTTTTGTTACAAAATAAAGTTAAACGCATCATATTTCAAGCTTGGTGCTCTTGTAATGGA
ACGGAGTAGTACAGCTTACGACGAATTGATGTGGCGGACGTATTTATGTGACAA