Description :
From Genome Similarity Track
Location :
contig_162:39072- 40419
Transcript NameFunction/comments
g11837.t1hypothetical protein PHYSODRAFT_473346

Sequence
1347 bases(100 bases per row)
GCACGCGTCGAAGTCCTCCGATGTCGTGTACCACTGCGTCGTGCACAGCCACTTGGATTGACACGCGACGTCCACGCACGACGACTGCAGGTACGACTGC
GCCTTCGAGTTGTAGTAGTACTGCTCCAACAAGGTCGGGTCCGACGCCAGCTCGATCCACGAACGCGTTGAGCTCCGACGTGCGCAGTGAACTCACGCCG
TACTCGGTGCTGGCCTTGAAGAGCGGCCTCCAGTCGAGTTCTTGGGTCGTGGAGACGTTGGAGCCGTACACGGTGAAGTCCAGCACCTCGTACGTGGTGG
CGTCGAAGTCCCAGACCATGAACGCCGGGTTGTTGTTGTAGATTGGTGAGATCGCCGCCGACATGAATAATGGTACCAGCTCCGCACCATCGGCCTCTTG
TTGAACCTTCTGCTCTGATGTTAGTGGCACACGGAACTCGATGCTGTGCACGTGGGCGAAGAACTGCGCCTTGATGATATCTGCGAACTGGTGCACGATC
TCCTTGTAGATGACAATGTACTCGGGTTCCCACATTTGCGCGCCGCTGTACGAGTCAATGATGGGCGGGATGTGGCCGACGACGTACGCGAACTTGTCCG
CGTTTCGAAGTTCCAGCAGAGTTTCGTTGAGCCATGCAAATTGCCCGAACGGGTCCGAAATGTTCGTCGTGTCTGGGGAATGACTGGGCTGAATCGCATG
ATACCAAGACAGTCAGATAGGCTGCTATATAGCGCGATGGTAACACCACCGGAGGACATATACAGCAGCTCTTTACCGAGTAGGGCACCGTGTTGAGCGT
CAAGACAACAAGCTTGTCATCGAGGTCATACGACAGGTAGCCGCGGCGGTTGAACCAGTCGAGGTTGGACTTGGACAGCGTATCTTCCCAGGCTGCTGAG
ATGAGTGCGATGGACGGGTTGACCTCCGTTTCTGGATCGGTCACGTTCATGTTGTAATCGGGGGCTGCGAGGAAAACGGAATGTGTTAGTGGTCATCGCC
CGAAGCGCATGTGATACATTGAGACGTACTTGTGTCAGCGTTGCCAATCAGGGCAGTGACGTCCAACTTTGTGTCGTTATCCTTGGTCGCGTAGTATTGA
GCCATGGTCTCGACATTTGTCTCCACTGTCTCGGCCTCGAACTCTTCGGACAGGTCACCGTGTGCGACGTGGTCGCCCGTGTAGAGGAAGAAATCGGGTC
GGGAATCAATTCCTTCGCGAACGCGAGTGCCGACGTCAAAAGCGTAATTGGCGCGTCGTCTCCATACGTGAGCTTAATCTCCACGGACTCTGTGGCATCC
AGCGACTCCGAAATATTCAGATGAACATCGGAAAAGTGCACGATGTG