Description :
From Genome Similarity Track
Location :
scaffold_243:39071- 40270
Sequence
1199 bases(100 bases per row)
CGCTTTGCCAAAGCTAGGTGCTCGTATCACTCTTGGTAGCACTTATAGTCAATCCACGTCTGCGCGGGTAGATCGAACTCCCTGGATCATCTGGCCATCA
TCAACTAGTGACCAAGATGGATTGAGGTGAGTTCCTTCATTGACCGACGCTCAATTTAGTCGGTTCAAAACATGTCGGACAGCTTTGGAGGCCCTCGTAG
CTTGGCGGTCACCGCACCTGTAACGGGGTTACATTAGGGTGACCCAATGATTGGGTACACCCGTATGAAGTACGTATCCACTTAAGGGATACTTCGGATC
GGTGGTGTACATCACACCACTGACACCAGCCAGGACGGCTGAGAGCCAACCAATGAGGTTTGGCGTTCATTGTATATAGGTTCTATTATAGGTACCTTAT
AGTTGTATGCAGGCCAAATTAAGGTAATTAACTATAAATACATTCAGTCTTAAATCTACCCTATTCTAGCTAAGTACAGCTAATTAGTCCCCTAAGACCG
GGGACTCGTGAACTGCTATTCACTTGGAGTTTGTATACTCCTGATAGCACGCTTCCTCTAAGCAAGGTGCTCGTGTGACCCCGTCACAGCACCGGCCGAG
CAGGCCGAACACATAGTGGCGTTCGACACCTATGTACGAGGTCTCATCGCTCATGTGCGGGGGTTGCATGCCCGACGTATGGACAGCAGCCAGCACAACC
CAAGCCACTAAGGCTCAAAGTTCGTACCTACGAAGGGAATAAGGGAGAGGACCTCCACTTCTTGGTCGGAAAAGTAGAGCTCGCGATAGACGCGACTCAC
GTCTTGACTGAGCGACTACGTGTCGCTTTCGCGCTGTCCAATCTTAACGGTCGAGGTAAGACATGGGTGTACACGCGCGAAGCGACATCCCCGGGCTGCT
TTGCAACCTGGTACAGTTGTGGGAACAGCTTCGAACCGCCTTCCTTTCCGGTGAACTATGAGTATCACTAGCGTGAATTACACGAGTACACCCAGGAGAT
GCGTGCGCTTGCCGCATCTCTGGTAGGGAATTCCCTACCTGGATATATCAGGTGAAAGTGTTCATGGATTGCTTGAGGCAAGCCCGACCCACACGCAATT
GTTCCGCGTGGAGGCTAGTACATACTATGGAGGATGAGATCCAGATCGCCTTCCAAGAGGGGTAATGCCCTGACAGGTTCATGCTCCAGGTTTTGTGTG