Description :
From Genome Similarity Track
Location :
scaffold_1214:3907- 6749
Transcript NameFunction/comments
Pl_101049hypothetical protein PHYSODRAFT_486359
Pl_101050hypothetical protein PHYSODRAFT_502885

Sequence
2842 bases(100 bases per row)
CGATCTCTTTTTTCGCTCGTTTCTTCCATTATCCAGGGAGACAATTAAACAGAACTTTACATTTCTTCTTTGTCCCGTCCTTCTCCGAAAACAGAGCTGG
CAAACCTTTTTTTCACTATCATGTTGCACAGGTGAAAGTAGTCCATTACTCGAGCATCGACATCGGACATAGTCATTGACATCACTAGTTGATACTGAAA
CAGCTCGTCAATTTTGGGCAAAGCGTTGGTTTTGAAGTTCCGCACGGTTGCCATGATCCAGTCCCACATAAACTCGTTTGTGAGATCATCGTTACTCTTC
TCCCGTTTTGTTTCTCAGTGTCTTGACGAGGCCGTGATCAAATGAGTTTCTCTCGGAACGCATGGCCGACTTCAAGTCTTGTCCAGAAGACTCACAACGC
GCCATCATGATCCCTTCATACTCCAGACGAAAGTCGACCCATCGGGTAAGCGCCTCATGTGAAATGTTTTCTCCCTTAGGTGCCACAGTGACCACGAATA
TCGGGTGTACTACTGCAGGGTAGTCAGGTTCCGGGCTGGCAGTCCTTGACACACAACTGCTTCCCGACCTTTGTGCCCATTGGTTTCCTGATTATTGAGC
CATACCGCCCCAAGATTGCGTGCGGGTTTGTTGGCTTTGATTCGACCTGACTTGGCTTGTCCCACTTGCGATGATCGTGTTACTGTCGTTGACCTAAACC
GTAATGTTCGATTTATGCTTGCCGTCCGGCTGAGTTGCCGCAGCAGCAGGAATCTCGTTCGTCGACGTAGTAGTTCCGTTGTCCATGTCATTTGCTTGGA
CCGCGAGTTAATTTTTGTGGTAGAAGCCGAATGAACACAGTCGCGAAGGAAGCTGGTGTTTCCTTAGTAGTCGTGATTGTATTGTAGTCTGTAAAATTCA
GAATGAAGTAAGTGAGATCCTAGTTAGATACTCCTACTGCAATTCCTATCGTCTTCCCCCACACACAACGCCTGAGCGTTGATTCGAAATGTACTCCGTC
AAATTTAAGAATCAAAACTTTGATCTCAAAATAGAACACGGAGGTTGGGTTAAGCTCGATTATTATAAGGGAAGTCGTGTGTGAACACTGCCACCTTCCA
TTACAACAGCAAGCACCCGACCATTTTTTTCTTTTCCATTTTACCACAATGGTCTCTAATAGCACCAAGAAAAACATCGTAGCTACACTATTAAGGACGA
GCTTTCAATCATTTTAGAGTACAAGGAAGGAGTCAATGGGAGCGGTTTTGTAGCGTTCAGTAAAAAGGACAAAGTCGCATTGGGGACTGGCTTCAAAATC
GCCACAAACTACAGAACGGCTCAAAGAACCGTCAAGCTACTGCCCGGTCCGTAAGACGGCTAAGTACCCAGAGCTAGAGGAACGTCTCCATGTGTGGGTT
CTTGACATGAACTCCAACGGATTACGTGTTAAGGACAACTACCTGCGGTTACAAGCCCAAAATGTCTATCGCTATTTATAGTCCTGCAGCACCCACATTT
GATGCATTAACCGGATGGTTGGTGAGATTTAAGAAGACGAAGCAGTTCGCCTCAAGTCGCCAGACAACTTCACGAACACTACCAGAAAAAGTGGTCCATA
GCATCAAAACACACAACATCATCAATATGGACCAAGTGCCTCGGTACTTTGAGATGGAACCAAAGACATCAATCACAACACAAGGATCATGCGAGGTACT
ACTACGTAAGGGCGGCACAAGTCACAAGCGATTTACAGCTACTTCCTCTATCACCACCTCCTCGTAAATATTGACACCACACATTTTTGTCGAAGTTGAA
GAAGTATGATGAGTACATTGGCAGGGCCATGCAGGATCCAGCGCGACAGACACGTACTGGGAACCCTAAGATCCCCGGCTACAATGCAGTCGCTCAATGG
ACTTTGGATTGGATGTCTATGCGAACACCTGATGACATAAAGATGGCGTTTGACATTTGTGGCCTGTTGCCAAACGAGATTTTTAGTGAAGATAAGCTGC
ATCAACCACTTAAGGAAATCCTGGCATCTGATTTAGACATTGAGAGCTGGCATGCATCCTACCAGGATCTACTGCAATAGACAGATGTCCGATAACAACT
GTGTGTTGCAGCGCCTGTATTGTACCTCCCATACGATGAATGTGAGAGTCTAATTTCCTGCCTCATCCATCGAATCGGTACATCACGAGACGATTATATG
TCGATCAGACGGATTATACGGCCTCACTAAAGGACATGGAAGGGTTAATTAATCCGTCTTAATTAACGGACATCATGCGAGGTGACCAGGTGAACTCGAG
CTGTTCTAAGCTACTTAGCGGTACAACTGGAGTATTAAGGTCAATACTATGAATTCCGATTGTAAGGTTGTGTCGAGGTTTGTCTACAGTGTGGATGCAT
GCACAAGACTGTGCAGCTTGTACGCAACGGGTCAGTCTTTGCTATCAAAGTTGATGGTTATGTGCTTTGATGCATCAGTGTAACAGCTCAGATACACACG
TCACTTGATGAATAAAGAACAAATACTTTAATTTTAGTTTTTATACAGAAAAATATTTATTGCAAAATCTCCGTATTTTACACAGCCACCAAGGAAAGAA
TAGACTTGTTACGTTACACACTCGATGTGACCAGCACACAGGCGGGTTTGAACCCCAAACAGTAGCATGGGAGGGTCAGGCTTACACCACTGACCAAGAT
TAAGGAACCACCAGTGTACTCTTCAAACTCTGCAAACATGTATAAAATCTTCGTTGCATAACGCGTAGGCGTTGTAATCAAATATTTTGTTTGCATTGAG
ATATTTGTATCATAACCCATGTGCGTTGTGTGCACGGGAAGA