Description :
From Genome Similarity Track
Location :
Scaffold_1165:3907- 4988
Transcript NameFunction/comments
Physo_126498PREDICTED: similar to Gag-Pol

Sequence
1081 bases(100 bases per row)
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNCATTGAGGTGGACCAGACTGATGAGGGCATCACCATTCGCCAGAGCAAGTATGCTCGAGAGGTATTGCAGACACTTG
GGTACGAGAACGCCCATGCAGTGGGCAACCCGATGGAGACAAATGTTCGGCTGGCGCCTTTGGATGCGAGTGAGGAGTCTGACACTAGCTTTGACTATCG
AAAGGCCGTCGGGATGTTGATGTACTTGGCTACGGGAACGAGACCCGACCTGGCGTTTGCAGTGGGGCAACTTAGTCGGTTCGTGGCCAAGCCATCTGCC
AGACACGTGGGGACACTGAAGCGTGTTCTGCGGTACCTTGCTGGTACAGTAGACTATGGCATATCGTATGAACGACCTACGGAGGTGCCAAGCACTATTG
TATTGGAAGGCTTTTGTGATAGTGACTGGGCCAATGACTCTGAGTCACGTAAGAGTACTACCGGGTTCGTGTTCTCGCTAGCAGGCGGAGCTGTGTCTTG
GATGTCACGTCGCCAATCGATCGTGGCCCTCTCAACGGCTGAGGCCGAGTATGTGGCCGCGTGTGAGGCTGCGATGGAGGCAGTTGCAGTCAGCAACATG
TTGCAGGAGATACTACCACAGCGAAGTGTGAAGCTGAAGATCGGGATTGACAACCAAGCGGCCCATGTGCTGGCGACCAACCCTACCTACAGTCGCCGTA
CCCGACACATCGAGCTGCGATGGCACTTCGTGCGTGAACAAGTGCAGAAGGGCGCAATTAACCTACGCAAGATGAAAGGTGCCGAGAACCCGGCGGATGC
GTTTACGAAGCCACTGGACAAGCAGCGACTGAAGGACCTGTTGTGGCTCGTGGGCGTGACCGGTGGCATGTGATGAAGCAA