Description :
From Genome Similarity Track
Location :
contig_20:390691- 391845
Transcript NameFunction/comments
g5014.t1hypothetical protein

Sequence
1154 bases(100 bases per row)
ACAAGAGCACGAAGCCACCTTGATCGTTGTTTCATCAAAAGAACACGGAAATTAAACTAGATTAAACTATCGGACTGCTGACTACAAAACAGTTGATTCC
GTCAGTATCTCCTCGGCGCGGGAGCAACAGCGGATTGATAGGGGGAATCGTTTCTCCCGCTCTAGCTTCACCTTCTTCATGTGGCACGGCTTGTAGTTGT
TATCACCGCCCTGGTTAATACAATCGTCCATTGACCCCTGCAAACTCAAACACGTTGCATTGATTGATCGTATTGGCAGTTCCCAGTACGACTCGGTGAC
TGCAGTAACCAACTCATCGATCGTGCGGGCGTTCTTTTTCCGCTGTCGCGCTTGAATTGCTGCAAAAAGCCCAAGATTATTGCAATTGAGATCTGGGCTG
TTCGGCGGTTGGGTGCGCAGCACCACACGACGACCACATGCAGCACCTGCATCTCAACAAACGCTTGATCACCTGAAGCAATGTGAGCAGGCGCATTGTC
TTGCTGGACGATAATTGGCTTATCATCAATGTCTGCAGGCCAACGCTCACACAAAACAGGCAGCAAATTAGCGATCAGCATGGCCCCATAGCCCTTTTTG
GTCACGAACATGTCCTTCGTGATGATCGTCCCCGCTGGACGACGCACTGAGAATCGCTGGGCTGGCACGCGCTCAACGAAGGGCCAAATGCTCAGCTTTC
TGTCGAAGACCTGTTATGTTACGGGGTCGAAGCGCGGGCGGCCAACCGCAGCCAAGAACATCACCTTAGTGATGTAGCGCTTGTTGCGAAGTCGTCGAAC
AGGCGCCTCTTCGTCAGGCAGGAGCAGGAAGCGTCGGGTCGGCTGAGTGATGTAAAATAGTTTTTCGTCTACGGGGACGGTGTCGAACATCTTGTTGTAC
AGATCGGCGAGGGCTTGGTTGCGCTCGGCATCAGTTAGGTTGGTCTTGCGAGCGGGGACTGACTTTTCCATGGTAATTGGTGATCTTTAGGCGAGGACGG
GCGAAATTACATTTGAGAATCTATGTTCCGGCCAGCGATGGCATGCCAGCGCTACTCAACCAACCGTTGTGTAACAAATACTGAGCTCTACAGACAACTG
AGTATACCAAACTACTGGCGGCAACGAGTCGCGTGTTTTGATTCAGACTATAGC