Description :
From Genome Similarity Track
Location :
Scaffold_10:39052- 40055
Transcript NameFunction/comments
g19045.t1POM72526.1 S-formylglutathione hydrolase [Phytophthora palmivora var. palmivora
g19046.t1hypothetical protein

Sequence
1003 bases(100 bases per row)
CGCTTCGGGCGCCTTGACGAACAGCAGCTCGTCGTTGCACGTGAGCCCCGCCAGGTAGAAGAGCACGGGCACCTTGTGGGCATCGCTGGCGTTGGGCGGA
AGGAAGATGCTGAACTTCATGCTGCACTTGGTGCTCGCGCTCTCATGCGAGTACTGCTTGACGACGCCCCCAAACGACTTAACCTGCTTCACGAGCTGCA
TACTGGAGACTTGACACGGATACTCTTCGACAATGATTCAGCTTCCGTGTCAGATCGTACTTAAGAGGACCAGTAAAAAAAATGTAGCCATATGAAGAGC
GACGTTCGCGCCTCTCGACGTGATGTTCAAGTCACCAGGAGCAGCACGAGAAGATGGAGCGACTAGTTCGTTGAGGGGCCTCCTATATCAAGATGCACAT
GTATTTCCTGATGATTTACCTAGATCAAAGCCACGACTTCGGAGAGAAGCGGCTGGATGGCTGGTGTCACGTTCAGGCGACGCAGCACTTCTGCGAGCCC
GAGCTCGATCGACAAACTGCGGGCGGCTTCGAAGTTGTGCAGCAAGCGACCAAGGCCGACGATTATGCCTTCGACCGTTTGGTGCTGCACAGAGGAAGCG
TTGGCGCGAGAAATTCGGTCGAGTGTCTCGACGGCGCCACAGACGATCGTGGTCACCACGACCTCCTCGCCGATCTTGAGCGCCAAGCAGCAGTTGCTCA
CGATATGCGCGCTCAACACGCGAGCGTCTTGGCTAGTGGAAGGGTCCGCAATGGTGGCGAACACGAACGGCAGGAATCGGGTCGAACCTGAGAGCGCCAC
GTCACTGAACGCAGGGTTGGCGAAGGCGTTCACGAGCACCGCCAGGAGCAGCGTCCTTTGCGCAGACGTCAGCGGCGAAGGCTCGACCTCCGTGGGTGCA
CCACTGCTTCAAAGCACGCCTTCTTCTCCGCTGAAGCTTCAGTCACATTTGCTGGCTGCAGCAACAGCACACGGGCCAAGCCCAGCGCTGGGAAAAAGAA
CGA