Description :
From Genome Similarity Track
Location :
Scaffold_165:3905- 8048
Transcript NameFunction/comments
Pytve_DAOMBR484maker-pve_contig_165-snap-gene-0.23GL24937
Pytve_DAOMBR484maker-pve_contig_165-fgenesh-gene-0.8Canalicular multispecific organic anion transporter

Sequence
4143 bases(100 bases per row)
TCGCAGAAGGCGTCGCGGCTCTCAACCGGCAGGTGCTGCTCGGAATCGGGCAGTGTCGACCGGAACCGGCCCTCCTGCACCCGCGCATGACTCGCGGTCA
GCTCGCGCCGCCGCGTCCAGACGACCTCGCCGCGCTCGAGCGCGTGCACCTCGCGCATCTGAGGACTCGCGATCACCCGCTGCAGCCTCGTGGGCGTCGC
CAGGTCGCCCCACCCGTCGCAGAAGAAGCCGCTCGGGAACAGCACCTTGTGCTGCGTGAGCGTCGCGGCCGCGCGGTCCAGCAGCCGGTGGTGCGCCGTC
GTGAACTGGTCCAGCAGGCGGCTCGGACCGCGCAGCACGAGCGCCAGTACGCCCCACGGGTGCACGCGCGGCTCGATCTCGAACTCGAGCGCCAGCGGTC
GCAGCCTCGACGTCAGCGGCGGCGGCCNNNNNNNNNNNNNNNNNNNNNNGGACGAGGACCGCCGCGAGCTAGCCATGGACGGCGCTGGCGCAGGGCGACG
GAGGCGTGGGGGTATGGAGGTGGGGTGTGGAGGTGGCGACGTGCGTGTGGCCCGGAGTGAGCGCGCGCCGTCGCGAATCTATGTGAACGGCAAGATCGAG
GTGACGAATTGCGAGAACATAGGAGCGAGGGGTGAAGCCACAGTGACAATTTAGGCCTATATTAGTGGATGACGCGCGGAGAATATCGGGGCAGTAGTGC
ACACTCTGTCTATTTGCGCTTAGAAACCCTACTCCTGACAATTTCTATCATGTGTCAGTAATTTACATGGTAAGTTACCATTCAGTCAGAATCGTTTCAC
CGAGGCGAAACATTACCGCCACTTCAACCTGCATAACTACCGTCACGACCGCGAAATATGATATTGCACTCACAGACTGAACGTGTGGAAGCTGCCGCCG
GGCACGACGTGCAGCCGCTCCAGCACTTCCTGCGCCGTCGGCCGTGAGCGCGGGTCGCGCTGGAGGCAGCTCCTCGCCAGCGCCGCAATCTCAGGCGGGC
AGTCGAGGGACAGCGTGGGCTGCAGCTCGCCGCTCATGACTCTCTGCAGGATCTGCGCCAGCGTCAGCTTGGTGTCCGCGTACGGCAGCGCGTTCGTGTC
GAGCTCGGTCAGCACCACGCCAAGCGAGTAAATGTCGGCCTTGGCGCCGTACTCTCGACTCTGTAGCACCTCGGGCGCCGTCCAGTACGGCGTGCCGACC
CCCTCGGTCAGGTCCTCGCGCTGCGATTCGATCAGTCGACTCGAGCCAAAGTCCGACAGCTTGGCCTCGAGCGAACCGGAAAGCAGCACGTTCTTGGACT
TCAAGTCGCGGTGCAAGACAGGAGGGTCGAGGTCGTGGTGGAGATAGCAGAGCGCCTGGACAATCCCCACCGCGATCCGCAGCTTCTCGCGCCGCCACGT
CAGCTGGTCGCCGCGGGTCACGAGGTACCGGTGCAGATCGCCGTTCTTCACGTACTCGGTGACCAGCCACAGTCGGTTCGCCGTCGAACTGGCAACGCCG
ATGAATTCGATGATGTTGGGGTGGTGCAGAGACGCCAACAGCGCCATCTCGCTCACGAAGCACTCCGTCGCACCTTCCTGCCGCCGCTTGGTGAGCCGCT
TGGCCGCCACGTGCCGGCTCCGGTGGATGCAGAGCCAGACCTCGCCGGACGCGCCTCGTCCAACCAGATGCAAGAATTGCAGCTCCTTGAACCCAATGAC
TGCGTTGCGCAGCACTGGAGCGCTCTGCAGCATTTCGACGGCGTTGGGGGCGTCGACATGAGGGGCGGCGTCGGCGTCCGAGGCTTTCGTGAGCGGGAAG
AACGCGCCAGAGAACACGATCGTCAAGTCGGTGTTCGGGCTGAGCGTGCGTGAGCACATGGTGGTCTCAGGGGTCAGTACTGTCAACGCTGACGTGGGTT
TCCGCCGCCGTGAGAACAGCCCGCGACCATCCTTTGGCTGGTTCGCGAGCTTGACGTGGTGTCGAAGAGCGAGAGCGACGGCCGCGCCTGTCAAGACCAC
GACAGCGATGATCGGGATCAGGATATATGACACGCGCGAGCCATGTTTCGTCCGTGATCGAGCCTCTTGCCGCAGCCAGGTGATTACCAGTGCTCCTGGC
TCTGGCCGACACCACGATCCCGTCGAGTTCGAGTACGGTGCACAAGGAATCACCATCGCTGGTCGCGCCTGGCAGCCTGCTCCAGTATTTTCAGTGTTTC
CAGCATCAAGAACGTAGAGAGTGTCCGTATTTGAGCTGTTCGAGGTCCAGCGGCGAACTTGGACGTTCGGGATCGACTCGGCATCTCCTCCATTCTCCCA
GACTGTCGCTTGAATCGAGGTGGTGGCTGTCGTTTTCTCGTCCAGAGAACATCGACTGGCCGTTGCGACCCGTTCGACTGCTTCGCAGTGCGTTGACAGG
CGCCAGGTGCTGTTCGCTGAGCACGTTTGCGTTATACATCCTGCACCTTGAACGTCATCCACAGAAAGCGCCAATTCTGCCATTGTAGCTCCACAGCTGG
AGTAAATCGGTATGAGCGAGTTGTCATCGTCGAGCGCAAAGCCAGAATCCCAAATCAGCGCGCGCTGGAGCAACGGTGAGAGTTCCGAAAAGTCCAACTT
GGACTCGTCCAGCCGCTTCTGGATCTCGTTGGGCAGTTCCTCGATCGAGAGTGGGTCGACTTCGTCTCCGGCCATGTGGCGCAGATAGAACTGCTGAGCC
AGGTCTGAAGAGTGTCCGTCATACACAAATGACGCATTGATTACAACTCCATTGTCGTCAAATTGGTCGTCAGACCCCCTGTCTGCTTCGTTTGGAGAAG
AAACCTTAGCCGGCGCGATGCCCAATGCTGCCGCGTACTCCTCCAGCCACCTCGTCAGCAACCCCGACGTCTTCGGGCGACACCACCGTCCTGCCGAGTC
TTTTGAGTACGGTATGCAGGGCACAATCACCGAGGAAGCCGACGAGCACGCGCTTTTGGTTGTTGTGGCTGCAGAGTCGACTTGTGAATGATTGGCGGAG
CCGTGGATCGCAAGAATCGAGTCGTCTGAGGCGATTGTGTGCTGACGCAGCACCAGATCAGGACGTGCGTCCCATTTCAGCAACGGTCGGTCTCCTGTCG
ACCAGAAGGGAGATCCGTCGACGCCACCTGATACATTCGTGCTTGCTGCTGCGCATTTTACGAGTGACTTGAGCTGATCAACGGATGAGCATGCGCTGGA
TGCAATAGCGGGTGAGCCAGCTTCAGAGGAGCACTCGACAGACGGACATTGGGTCTCCTGGAACTCTTCGGCCGAGAGACCAATGTCTGCCATGGTTTCC
GCGCGTTCGCAGTCTGTGTAGACCGCAGTGAGCGTGCCGCCATCGCTGTTGAGCAGGTAGCCGCTGTCCCACACAACAGCGAGCTGGAGAAGTTCTGGCA
GCTTCTCAAACTTCAACGAGAAGTCTACGAGTCGCTCGGTAACTTCGTTGGGGACGGCCTGGCGAAGTTTCACCGTAGCCGTGCTGGTAGCATTTGTGTC
GGCCATCGCGTGCTGCCAGAAGAGCTTGTAGTACAGGGTGATAAAGTCCGACGACGGACCCGTGCTGTTGTCGGCAGTCGGGAGCGCTGACGCCAGCGCT
GGCCATGGAGGCGAGAGCGCGATCGCGGCGAGGGCCAGGTAGCGCCTCATGGCCGCTCGCGCGAGTACGGGAAGTGCGCTGCGGACCGCGGCCCCGATCT
ACGTTTCGGCATGCGGGACTGTGAATTGCTGTCAGCTAATGCAAACGGTCGACTCGCTCGTTCTTTCCGCGTTCCGTCGGCCACGCTTGATTTCCGTCCA
GGAGCGGCGGCGATAGGCAAAGGGGGTTATGCTACTGGGCCGCGGTGTTTCGAATGGAAGCGTGCACCCATGTGTTTGCTTCGAAAGTCGCGTGGAGCTG
CCGAGTGTACGGCGGACGGTTCGCGGTCCGTTCGGTCGCTAACGGAACCGCGTCTTTCCGCGAGGTGTCGACGATCGGCGAACTCGATTTTGGACGCTGA
GGTGTGTCCTATAACATTAGAGCTAGTCAAGTATTTTGTAAACCAAACACATTTATTATTCAGGAATAGAAATGTTGGCGCCATGTCAAGGATCTGCTCG
AGTTGCTTCAGTTTGCCATCGAGCGCTTCACGAGCGACGCAAA