Description :
From Genome Similarity Track
Location :
contig_57:39044- 40542
Sequence
1498 bases(100 bases per row)
TTGAAAATATCAATGACTTGGCTATCTGGCTTCCGTTCATAGTTTGCGCTAGGATCGCGGCGGCTGGGGCATCTCCAACGTATCATTAAAAGATCCTTGC
CCTCATTTGTTGTTCGCTGTCTGGGTACCGCTAATGTCTCCATCGGGGTCATGCACAGATCATATAGCCTTTTCGGCTCAGCAGATTCTATGGTCTCCTC
TTGTTCCATCCCTTTGACCACTGCCCCAAGGTAGGAGATTGGTTTGCTCTCGCTTTAGTGCTCTCCAGCTTCGTCAATTGTAGTCTCCGGATCCACGAAA
GTGAATAATCACAGTCTATCATCCAGCTCACCTTGCGTACTGTGCGCAATTGTGATGCACGTGTGCATCATCTGCTGTTGTCGCGTGAGCACGTGCTGCC
TTGCGTTTGTTCCAATAACCCCGGAGTCGGCGGTACTTCAGCTCCATCGTCTCTGGTATCGGGTCACTCCATTTCGTTTTCTCTGCTTCGGATGGCAGCC
CAGAATCCTTCTCTTTCAGCTTCCCCCAATGCTCTTGGAATCGATGCTGTCTCGCCATGTCCGTCAGTCGTAGTACGGTGCCGTACATATTGCCTCGGCT
GTGTTGCTGAGCAGGTAAATCCGCAATTATTTGAAAATCACCTGTCCGTCTCCCATATCTGCACTATTTGGCTTTGTTCCTGGGGTTCTCAGATTTCCTT
CCTTGATTCCTTCTATCAGCCAGTGCCGTCGTGGCGATAGCTTCCGTCCGCTCTACTTGTTCATCCTTGCGCGCTGCCGTGTTGTCCCGCTCTCCTTCCC
ATCTGCCGTTGGACGGCCTTTAGTTCTGCCTACGATTCTCCCCTCGCTTGCCGCATTGGTTTTGCTCTCCATCATCAGTAGTCACCCTTGAAACCTCGCG
TTCTGCTCGACCTCTTGTCCAGCCGGCCCCTGGTCCTGCTCGCTGTGCTCAACGTACTCCCAGCCGTGATTTCCTTCGGCGATCTTTTCGTTATCTGTCT
TTTTTGCCCCCCCCCCCCCCCCCCCAGTAACCGGGTCGGTTGTTGCTGTATTCGCTGGACTTTGGCCCACGAAGTATCAGTATCAGTATCGTGAGCGGGA
GCCGGCGGATTTGGATGATGGCCTACCTTACGCACACGTGCCCTGAACAGACAGCTCCCGCGAAGAGAAACCATCGTTTCGGCACACACACAATAGAGGT
TCCGCAGCCCAACCTCATTAACCTACGGCCAGGTACACCGCGACCGTCGTATCCGATATGAGGGGCGACCCCAGACACAATTCAACACGGGGTGATCCCA
TTTCAGCATTCGTCATCATGAGCGTCCGTACACCGTAGACGAAGGGGGCTAACCAACGATCTGTTCTCGGCAATACTCCGGACGATCAGGTTATAAGTGC
TCAATGACAGTCAAGGGCAGTCCATCAACACAGCCCACCAGTGTGCAGGCACTTGGTGAGAGTGAGCAACAATCTGTCAGCCTAGCGCTCTGGTGTGC