Description :
From Genome Similarity Track
Location :
Scaffold_2275:3904- 5008
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_2275-fgenesh-gene-0.1Aspartic protease

Sequence
1104 bases(100 bases per row)
GCCGTCGTTTTCCACGTCAAACGCAATGAAAAACAGACCGGGCTGGCCTTGCGGCTCGTTTTCCATCGAAAAGAGACGGTCGTCAAATGGAAGAAAACGT
CCCGTGGACTTTCTCTTCCCTCGATTTGGTGAAAGTCTCCTGCCGCCTGCCTCAGCGATTCCAAGCTGTCTCATCACTCAGTGCAGTGCTGTGCCATGTA
CATGACACGAGACAGACGGCGAAAACGAGTGCGTGCTGCGAGGATCTTTCCACTGTACCAAATGGAGCGATTCAAGCTTCCTCAGCTCGCGGCGGGAGCT
CTGCATGAGTACTCATCTCAACGCAGAGTCTTTGAACCACCGGCTTTCCCCTTCAGTCTCCAATTTTCCCTCGCCACACACACGCACGCACAAACCTGAC
GAGTCTCATGGGCCGTGCATTGGTCGCCCTCTTCAGCGCGGCGCTCGTCGCTCTCTTCTGTGCGATGTTGGTTGACGCTGCGGTTGTGACTGTCTCGATC
AACAAACCGGAAGACCGATCGTACGAGGGCGGCGATTTGCCCTCGAGTCCGCGTGTGTCGGTCAACAAGGTCGGGTCCGTCGTGATCGAGAACTTCCAGA
ACGCGCAGTACTATGGCAAGATCCAGTTGGGTACACCGCCACAGACGCTCACCGTCATTTACGACACTGGGTCGAGCAACCTGTGGGTGCTCAACAAGCG
CCTGGGCCAGCACAGCTTCTACCAGAGCAAGCAGTCGTCGACCTACAAGGCCAACGGCACGAGGTTTCAAATCGCCTACGGCAGCGGTGACGTCTCAGGC
TTTATTTCGCAGGACACGTTATCGTTTGGCGGCCTCACGGTGAAGAACCAGCTCTTCGCCGAGGTCAACAATGCCTCCGGCCTGGGCGCCGACTTTGTGA
GCAGCAACTTTGACGGCATTCTCGGACTGGGCTTTGACTCCATCGCCGAAAACAATATCCCGACGCCGTTCAAGCGGCTTGTCGACTCGGGCGCGCTGGA
CGAACCGGTGTTTGCCTTCTACCTGGGCAATAATGTCGCCGGCGAACTCACGCTCGGTGGCGTCGACACGAAGCGATTCGAGGGGAAAATCTATTACACG
CCCG